Incidental Mutation 'R1615:Ccr1'
ID177059
Institutional Source Beutler Lab
Gene Symbol Ccr1
Ensembl Gene ENSMUSG00000025804
Gene Namechemokine (C-C motif) receptor 1
SynonymsCmkbr1
MMRRC Submission 039652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R1615 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123962124-123968692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123963536 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 319 (H319R)
Ref Sequence ENSEMBL: ENSMUSP00000026911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026911]
Predicted Effect probably benign
Transcript: ENSMUST00000026911
AA Change: H319R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026911
Gene: ENSMUSG00000025804
AA Change: H319R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 45 316 5.1e-8 PFAM
Pfam:7tm_1 51 301 8.5e-52 PFAM
Meta Mutation Damage Score 0.1448 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The ligands of this receptor include macrophage inflammatory protein 1 alpha (MIP-1 alpha), regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3), and myeloid progenitor inhibitory factor-1 (MPIF-1). Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. This gene and other chemokine receptor genes, including CCR2, CCRL2, CCR3, CCR5 and CCXCR1, are found to form a gene cluster on chromosome 3p. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered trafficking and proliferation of myeloid progenitor cells, and impairments in granulomatous inflammation of the lung and neutrophil associated host defense. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C T 9: 58,499,068 A87V probably damaging Het
Adcy8 A T 15: 64,871,776 C328S probably benign Het
Adgrv1 G T 13: 81,424,288 T4918K probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Amer3 T C 1: 34,588,171 M497T probably damaging Het
Arid2 C T 15: 96,371,654 T1216M possibly damaging Het
Birc6 A G 17: 74,609,409 probably null Het
Bzw2 A G 12: 36,119,127 probably benign Het
Dnah11 A G 12: 118,050,722 I2010T probably damaging Het
Dnhd1 A G 7: 105,703,206 Y2522C probably benign Het
Dnhd1 T A 7: 105,713,706 I3825K possibly damaging Het
Dst A T 1: 34,199,371 D3718V probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Fbxw21 T C 9: 109,143,726 Y380C probably damaging Het
Fhad1 G A 4: 141,922,323 T836M probably damaging Het
Fhod1 C T 8: 105,347,831 probably benign Het
Flt1 A G 5: 147,639,288 C637R probably damaging Het
Fmnl2 A G 2: 53,118,424 K809E probably damaging Het
Grm1 G T 10: 10,741,508 Y510* probably null Het
Hey1 A T 3: 8,664,838 H186Q possibly damaging Het
Itga2b C T 11: 102,460,137 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lmcd1 A G 6: 112,273,950 D7G probably benign Het
Lrrc1 T C 9: 77,435,118 D358G possibly damaging Het
Lyn A G 4: 3,748,765 K248E probably benign Het
Map4k4 A G 1: 40,006,830 probably benign Het
Map4k5 A T 12: 69,844,413 L160H probably damaging Het
Myo6 C T 9: 80,307,725 R1247C probably damaging Het
Myo9a A G 9: 59,788,456 E347G possibly damaging Het
Ndfip1 C T 18: 38,460,619 P213S probably benign Het
Neurl3 T C 1: 36,269,389 E114G possibly damaging Het
Nlrp14 A T 7: 107,196,163 I877F probably benign Het
Obscn A G 11: 59,099,825 S1733P probably benign Het
Oxgr1 A T 14: 120,022,773 S7R probably benign Het
Plcb1 A T 2: 135,362,444 probably benign Het
Prkag2 G T 5: 24,875,178 N120K possibly damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Saraf A G 8: 34,165,288 K174E possibly damaging Het
Scrib T C 15: 76,066,205 Q264R probably benign Het
Sh3rf3 T A 10: 59,131,077 M747K probably benign Het
Shf T C 2: 122,349,432 H421R probably damaging Het
Slc35g3 A G 11: 69,760,542 S228P probably damaging Het
Slit1 A G 19: 41,650,671 probably benign Het
Soga1 T G 2: 157,020,743 H1422P probably damaging Het
Srrm4 A G 5: 116,447,300 probably benign Het
Stfa1 T G 16: 36,280,467 V23G probably damaging Het
Swap70 A G 7: 110,273,291 D371G probably benign Het
Tada2a T C 11: 84,103,100 D186G probably damaging Het
Tdpoz3 C A 3: 93,826,311 Q98K probably benign Het
Tgfbrap1 A G 1: 43,051,985 V660A probably benign Het
Tnn A G 1: 160,118,408 Y947H possibly damaging Het
Trim60 A T 8: 65,000,510 C362* probably null Het
Vmn1r81 T A 7: 12,260,514 N56Y probably damaging Het
Vsig8 A G 1: 172,559,713 D52G probably damaging Het
Wdfy4 G A 14: 33,042,512 R2140C probably damaging Het
Other mutations in Ccr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ccr1 APN 9 123964053 missense probably benign 0.22
IGL00550:Ccr1 APN 9 123963636 missense probably damaging 1.00
IGL00934:Ccr1 APN 9 123963740 missense probably damaging 0.98
IGL01795:Ccr1 APN 9 123964112 nonsense probably null
IGL02447:Ccr1 APN 9 123963716 missense probably benign 0.01
PIT4431001:Ccr1 UTSW 9 123964194 missense probably benign
PIT4466001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
PIT4472001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
R0900:Ccr1 UTSW 9 123964334 missense possibly damaging 0.50
R0931:Ccr1 UTSW 9 123963790 missense probably damaging 1.00
R1165:Ccr1 UTSW 9 123963494 missense possibly damaging 0.51
R1386:Ccr1 UTSW 9 123963962 missense probably benign 0.05
R1513:Ccr1 UTSW 9 123964473 missense probably benign 0.00
R1833:Ccr1 UTSW 9 123964089 missense probably damaging 1.00
R1996:Ccr1 UTSW 9 123963514 missense probably benign 0.41
R3833:Ccr1 UTSW 9 123964287 missense possibly damaging 0.74
R4085:Ccr1 UTSW 9 123963950 missense probably benign
R4545:Ccr1 UTSW 9 123964400 missense probably benign 0.11
R4745:Ccr1 UTSW 9 123963948 missense probably benign 0.05
R5369:Ccr1 UTSW 9 123964289 missense probably damaging 0.98
R5415:Ccr1 UTSW 9 123964376 missense probably damaging 1.00
R5416:Ccr1 UTSW 9 123964376 missense probably damaging 1.00
R6446:Ccr1 UTSW 9 123964106 missense probably damaging 0.99
R7179:Ccr1 UTSW 9 123964052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCATGCCACTCATTGTCAC -3'
(R):5'- CATTTCCCCTACAAGAGCCTGAAGC -3'

Sequencing Primer
(F):5'- GGAATCCTGACTGTAAGAACTGTC -3'
(R):5'- ATCTGCTATGCAGGGATCATCAG -3'
Posted On2014-04-24