Incidental Mutation 'R1615:Rnf43'
ID177066
Institutional Source Beutler Lab
Gene Symbol Rnf43
Ensembl Gene ENSMUSG00000034177
Gene Namering finger protein 43
Synonyms
MMRRC Submission 039652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1615 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87662722-87735539 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 87731659 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 529 (R529*)
Ref Sequence ENSEMBL: ENSMUSP00000130685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040089] [ENSMUST00000092800] [ENSMUST00000121782] [ENSMUST00000165679]
Predicted Effect probably null
Transcript: ENSMUST00000040089
AA Change: R402*
SMART Domains Protein: ENSMUSP00000044241
Gene: ENSMUSG00000034177
AA Change: R402*

DomainStartEndE-ValueType
PDB:4KNG|F 1 71 7e-32 PDB
transmembrane domain 72 91 N/A INTRINSIC
RING 145 185 6.43e-8 SMART
low complexity region 337 351 N/A INTRINSIC
low complexity region 366 376 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
low complexity region 646 654 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092800
AA Change: R529*
SMART Domains Protein: ENSMUSP00000090476
Gene: ENSMUSG00000034177
AA Change: R529*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121782
AA Change: R488*
SMART Domains Protein: ENSMUSP00000112748
Gene: ENSMUSG00000034177
AA Change: R488*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 157 6e-54 PDB
transmembrane domain 158 177 N/A INTRINSIC
RING 231 271 6.43e-8 SMART
low complexity region 423 437 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 577 602 N/A INTRINSIC
low complexity region 732 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162740
Predicted Effect probably null
Transcript: ENSMUST00000165679
AA Change: R529*
SMART Domains Protein: ENSMUSP00000130685
Gene: ENSMUSG00000034177
AA Change: R529*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Meta Mutation Damage Score 0.6244 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RING-type E3 ubiquitin ligase and is predicted to contain a transmembrane domain, a protease-associated domain, an ectodomain, and a cytoplasmic RING domain. This protein is thought to negatively regulate Wnt signaling, and expression of this gene results in an increase in ubiquitination of frizzled receptors, an alteration in their subcellular distribution, resulting in reduced surface levels of these receptors. Mutations in this gene have been reported in multiple tumor cells, including colorectal and endometrial cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C T 9: 58,499,068 A87V probably damaging Het
Adcy8 A T 15: 64,871,776 C328S probably benign Het
Adgrv1 G T 13: 81,424,288 T4918K probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Amer3 T C 1: 34,588,171 M497T probably damaging Het
Arid2 C T 15: 96,371,654 T1216M possibly damaging Het
Birc6 A G 17: 74,609,409 probably null Het
Bzw2 A G 12: 36,119,127 probably benign Het
Ccr1 T C 9: 123,963,536 H319R probably benign Het
Dnah11 A G 12: 118,050,722 I2010T probably damaging Het
Dnhd1 A G 7: 105,703,206 Y2522C probably benign Het
Dnhd1 T A 7: 105,713,706 I3825K possibly damaging Het
Dst A T 1: 34,199,371 D3718V probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Fbxw21 T C 9: 109,143,726 Y380C probably damaging Het
Fhad1 G A 4: 141,922,323 T836M probably damaging Het
Fhod1 C T 8: 105,347,831 probably benign Het
Flt1 A G 5: 147,639,288 C637R probably damaging Het
Fmnl2 A G 2: 53,118,424 K809E probably damaging Het
Grm1 G T 10: 10,741,508 Y510* probably null Het
Hey1 A T 3: 8,664,838 H186Q possibly damaging Het
Itga2b C T 11: 102,460,137 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lmcd1 A G 6: 112,273,950 D7G probably benign Het
Lrrc1 T C 9: 77,435,118 D358G possibly damaging Het
Lyn A G 4: 3,748,765 K248E probably benign Het
Map4k4 A G 1: 40,006,830 probably benign Het
Map4k5 A T 12: 69,844,413 L160H probably damaging Het
Myo6 C T 9: 80,307,725 R1247C probably damaging Het
Myo9a A G 9: 59,788,456 E347G possibly damaging Het
Ndfip1 C T 18: 38,460,619 P213S probably benign Het
Neurl3 T C 1: 36,269,389 E114G possibly damaging Het
Nlrp14 A T 7: 107,196,163 I877F probably benign Het
Obscn A G 11: 59,099,825 S1733P probably benign Het
Oxgr1 A T 14: 120,022,773 S7R probably benign Het
Plcb1 A T 2: 135,362,444 probably benign Het
Prkag2 G T 5: 24,875,178 N120K possibly damaging Het
Saraf A G 8: 34,165,288 K174E possibly damaging Het
Scrib T C 15: 76,066,205 Q264R probably benign Het
Sh3rf3 T A 10: 59,131,077 M747K probably benign Het
Shf T C 2: 122,349,432 H421R probably damaging Het
Slc35g3 A G 11: 69,760,542 S228P probably damaging Het
Slit1 A G 19: 41,650,671 probably benign Het
Soga1 T G 2: 157,020,743 H1422P probably damaging Het
Srrm4 A G 5: 116,447,300 probably benign Het
Stfa1 T G 16: 36,280,467 V23G probably damaging Het
Swap70 A G 7: 110,273,291 D371G probably benign Het
Tada2a T C 11: 84,103,100 D186G probably damaging Het
Tdpoz3 C A 3: 93,826,311 Q98K probably benign Het
Tgfbrap1 A G 1: 43,051,985 V660A probably benign Het
Tnn A G 1: 160,118,408 Y947H possibly damaging Het
Trim60 A T 8: 65,000,510 C362* probably null Het
Vmn1r81 T A 7: 12,260,514 N56Y probably damaging Het
Vsig8 A G 1: 172,559,713 D52G probably damaging Het
Wdfy4 G A 14: 33,042,512 R2140C probably damaging Het
Other mutations in Rnf43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Rnf43 APN 11 87731892 missense probably benign 0.15
IGL01520:Rnf43 APN 11 87664716 missense probably damaging 1.00
IGL01541:Rnf43 APN 11 87730220 missense probably null 1.00
IGL01784:Rnf43 APN 11 87731806 missense possibly damaging 0.56
IGL02037:Rnf43 APN 11 87731653 missense probably benign 0.00
IGL02725:Rnf43 APN 11 87731585 missense probably damaging 1.00
IGL03062:Rnf43 APN 11 87732304 nonsense probably null
R0226:Rnf43 UTSW 11 87731437 missense probably damaging 1.00
R0391:Rnf43 UTSW 11 87731282 missense possibly damaging 0.86
R0834:Rnf43 UTSW 11 87731251 missense probably benign
R1163:Rnf43 UTSW 11 87729513 missense probably damaging 0.98
R1203:Rnf43 UTSW 11 87727475 splice site probably benign
R1314:Rnf43 UTSW 11 87732319 missense probably benign
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1511:Rnf43 UTSW 11 87731347 missense probably benign 0.00
R1513:Rnf43 UTSW 11 87729431 missense probably damaging 1.00
R1614:Rnf43 UTSW 11 87731659 nonsense probably null
R2341:Rnf43 UTSW 11 87732025 missense probably damaging 0.96
R2410:Rnf43 UTSW 11 87732259 missense possibly damaging 0.94
R2847:Rnf43 UTSW 11 87732267 missense probably benign 0.04
R2849:Rnf43 UTSW 11 87732267 missense probably benign 0.04
R5567:Rnf43 UTSW 11 87727445 missense probably damaging 1.00
R5943:Rnf43 UTSW 11 87731735 missense probably damaging 1.00
R6135:Rnf43 UTSW 11 87732125 missense probably damaging 1.00
R6452:Rnf43 UTSW 11 87732253 missense probably damaging 1.00
R6511:Rnf43 UTSW 11 87732163 missense probably benign 0.01
R7426:Rnf43 UTSW 11 87731852 missense probably benign 0.03
R7528:Rnf43 UTSW 11 87732128 missense not run
X0064:Rnf43 UTSW 11 87727342 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AATCGCCTCCGATGTACCTCTCAG -3'
(R):5'- TTTCTGCAAGTTCAAAAGACCGCTG -3'

Sequencing Primer
(F):5'- CAGAACGCAGCGGTTACTTG -3'
(R):5'- ttgggactggggctagg -3'
Posted On2014-04-24