Incidental Mutation 'R1569:Yes1'
ID177108
Institutional Source Beutler Lab
Gene Symbol Yes1
Ensembl Gene ENSMUSG00000014932
Gene NameYES proto-oncogene 1, Src family tyrosine kinase
SynonymsYes
MMRRC Submission 039608-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R1569 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32611171-32687057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32653163 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 192 (Y192C)
Ref Sequence ENSEMBL: ENSMUSP00000144355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072311] [ENSMUST00000168707] [ENSMUST00000200999] [ENSMUST00000202543]
Predicted Effect probably damaging
Transcript: ENSMUST00000072311
AA Change: Y192C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072154
Gene: ENSMUSG00000014932
AA Change: Y192C

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155976
Predicted Effect probably damaging
Transcript: ENSMUST00000168707
AA Change: Y192C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132161
Gene: ENSMUSG00000014932
AA Change: Y192C

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200999
AA Change: Y192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144355
Gene: ENSMUSG00000014932
AA Change: Y192C

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 3.1e-24 SMART
SH2 154 198 2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202543
AA Change: Y192C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144001
Gene: ENSMUSG00000014932
AA Change: Y192C

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null alleles have no overt phenotype, but mice homozygous for both Yes and Src null mutations exhibit impaired movement and breathing, resulting in perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Atp6v0a4 A G 6: 38,050,625 V750A probably damaging Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Celsr3 A G 9: 108,829,068 T917A probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Fcrl1 A G 3: 87,384,705 Y57C probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lck C A 4: 129,555,656 D283Y probably damaging Het
Lcmt2 A G 2: 121,139,828 F258S probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Ppp1r18 A G 17: 35,868,703 E62G probably damaging Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Shbg T A 11: 69,617,589 probably benign Het
Slc15a2 T C 16: 36,756,383 T430A probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp560 A T 9: 20,348,715 C284S possibly damaging Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Yes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Yes1 APN 5 32655129 missense probably benign 0.00
IGL02816:Yes1 APN 5 32645107 missense probably damaging 1.00
IGL02974:Yes1 APN 5 32660768 missense probably damaging 0.97
PIT4696001:Yes1 UTSW 5 32684625 missense possibly damaging 0.70
R0139:Yes1 UTSW 5 32684695 missense possibly damaging 0.87
R0481:Yes1 UTSW 5 32640405 nonsense probably null
R0486:Yes1 UTSW 5 32655582 nonsense probably null
R0526:Yes1 UTSW 5 32655240 missense probably benign 0.15
R0648:Yes1 UTSW 5 32655518 missense possibly damaging 0.90
R1083:Yes1 UTSW 5 32651757 critical splice donor site probably null
R1463:Yes1 UTSW 5 32651702 missense probably benign 0.04
R1899:Yes1 UTSW 5 32645051 missense probably damaging 1.00
R1918:Yes1 UTSW 5 32684735 missense probably benign 0.00
R2183:Yes1 UTSW 5 32645026 missense probably damaging 1.00
R2913:Yes1 UTSW 5 32640582 missense probably benign
R2914:Yes1 UTSW 5 32640582 missense probably benign
R3104:Yes1 UTSW 5 32653171 missense probably damaging 1.00
R4407:Yes1 UTSW 5 32640585 missense possibly damaging 0.51
R4736:Yes1 UTSW 5 32660777 missense probably damaging 0.98
R4939:Yes1 UTSW 5 32645113 splice site probably null
R6187:Yes1 UTSW 5 32645041 missense probably damaging 1.00
R6318:Yes1 UTSW 5 32651686 missense possibly damaging 0.92
R6467:Yes1 UTSW 5 32653037 missense probably damaging 0.98
X0062:Yes1 UTSW 5 32653043 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCGGAAAGATTACTTCTGAATCCTGG -3'
(R):5'- GGGCAACATGCAAGTCTTGTTCCTC -3'

Sequencing Primer
(F):5'- GGAATCAGCGAGGTATTTTCTTAG -3'
(R):5'- ttcatccataggagccacatag -3'
Posted On2014-04-24