Incidental Mutation 'R1569:Celsr3'
ID177125
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Namecadherin, EGF LAG seven-pass G-type receptor 3
SynonymsFmi1, flamingo
MMRRC Submission 039608-MU
Accession Numbers

Genbank: NM_080437; MGI: 1858236 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1569 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108826320-108852969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108829068 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 917 (T917A)
Ref Sequence ENSEMBL: ENSMUSP00000024238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]
Predicted Effect probably damaging
Transcript: ENSMUST00000024238
AA Change: T917A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: T917A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192235
SMART Domains Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
EGF 108 163 4.9e-5 SMART
EGF 168 201 2.6e-6 SMART
EGF_like 208 239 1.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194742
Predicted Effect probably benign
Transcript: ENSMUST00000213524
AA Change: T917A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Atp6v0a4 A G 6: 38,050,625 V750A probably damaging Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Fcrl1 A G 3: 87,384,705 Y57C probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lck C A 4: 129,555,656 D283Y probably damaging Het
Lcmt2 A G 2: 121,139,828 F258S probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Ppp1r18 A G 17: 35,868,703 E62G probably damaging Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Shbg T A 11: 69,617,589 probably benign Het
Slc15a2 T C 16: 36,756,383 T430A probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Yes1 A G 5: 32,653,163 Y192C probably damaging Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp560 A T 9: 20,348,715 C284S possibly damaging Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108848925 missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108829192 missense probably benign 0.33
IGL00552:Celsr3 APN 9 108841263 missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108842576 missense probably benign
IGL01420:Celsr3 APN 9 108841190 critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108831708 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108834557 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01631:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01777:Celsr3 APN 9 108835942 missense probably benign 0.08
IGL01938:Celsr3 APN 9 108828415 missense probably benign 0.34
IGL02135:Celsr3 APN 9 108827556 missense probably benign 0.11
IGL02231:Celsr3 APN 9 108842510 missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108829960 missense probably benign
IGL02392:Celsr3 APN 9 108834721 splice site probably benign
IGL02416:Celsr3 APN 9 108832119 missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108840463 missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108842893 missense probably benign 0.15
IGL02798:Celsr3 APN 9 108843575 missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108849453 missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108845935 missense probably benign 0.12
IGL02986:Celsr3 APN 9 108841255 unclassified probably null
IGL03089:Celsr3 APN 9 108826607 missense probably benign 0.04
IGL03162:Celsr3 APN 9 108842558 missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108836525 splice site probably benign
F6893:Celsr3 UTSW 9 108835067 missense probably benign 0.00
R0110:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108843724 splice site probably benign
R0382:Celsr3 UTSW 9 108829218 missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108829073 nonsense probably null
R0510:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108827692 missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108834655 missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108827818 missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108842633 missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108846025 missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108833176 missense probably benign 0.17
R1321:Celsr3 UTSW 9 108835870 missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108826905 missense probably benign 0.00
R1497:Celsr3 UTSW 9 108848865 missense probably benign 0.14
R1520:Celsr3 UTSW 9 108848658 missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108848884 missense probably damaging 0.99
R1657:Celsr3 UTSW 9 108842952 nonsense probably null
R1753:Celsr3 UTSW 9 108831857 missense probably damaging 0.99
R1764:Celsr3 UTSW 9 108828958 missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108834626 missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108829906 missense probably benign
R1839:Celsr3 UTSW 9 108829906 missense probably benign
R1874:Celsr3 UTSW 9 108835838 missense probably benign
R1875:Celsr3 UTSW 9 108835838 missense probably benign
R1953:Celsr3 UTSW 9 108843182 missense probably benign 0.19
R1960:Celsr3 UTSW 9 108845817 missense probably benign
R2113:Celsr3 UTSW 9 108838470 missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108843224 missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108842552 missense probably benign
R2373:Celsr3 UTSW 9 108842552 missense probably benign
R2374:Celsr3 UTSW 9 108842552 missense probably benign
R2375:Celsr3 UTSW 9 108842552 missense probably benign
R2844:Celsr3 UTSW 9 108829308 missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108832191 missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108837139 missense probably benign 0.31
R3159:Celsr3 UTSW 9 108827710 missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108842552 missense probably benign
R4194:Celsr3 UTSW 9 108843302 critical splice donor site probably null
R4329:Celsr3 UTSW 9 108846049 missense probably benign 0.00
R4365:Celsr3 UTSW 9 108829847 missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108843244 missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108846063 critical splice donor site probably null
R4582:Celsr3 UTSW 9 108845723 missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108827754 missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108847652 missense probably benign 0.05
R4881:Celsr3 UTSW 9 108843941 missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108849421 missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108837560 missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108832759 missense probably benign 0.01
R5290:Celsr3 UTSW 9 108843158 missense probably benign 0.01
R5327:Celsr3 UTSW 9 108842708 intron probably benign
R5345:Celsr3 UTSW 9 108832124 missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108832025 missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108828582 missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108840042 missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108844034 missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108828637 missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108844544 critical splice donor site probably null
R5629:Celsr3 UTSW 9 108849067 missense probably benign 0.41
R5637:Celsr3 UTSW 9 108837133 missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108838472 missense probably benign 0.03
R5739:Celsr3 UTSW 9 108827158 missense probably benign
R5785:Celsr3 UTSW 9 108827797 missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108845727 missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108831794 missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108837151 missense probably benign 0.01
R6176:Celsr3 UTSW 9 108828355 missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108828842 missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108835790 missense probably benign 0.08
R6481:Celsr3 UTSW 9 108837084 missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108829128 missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108827350 missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108829191 missense probably benign 0.02
R6977:Celsr3 UTSW 9 108827715 missense probably benign
X0018:Celsr3 UTSW 9 108827778 missense possibly damaging 0.65
X0018:Celsr3 UTSW 9 108840412 missense probably benign 0.01
X0026:Celsr3 UTSW 9 108828930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCATGAATGAAGACCGCCCAG -3'
(R):5'- GGCTCAATGGTAAAATCCCCATCCC -3'

Sequencing Primer
(F):5'- CCAGTGGGTAGCACTGTG -3'
(R):5'- ATCCCTGTCAGTGGCTGAG -3'
Posted On2014-04-24