Incidental Mutation 'R1569:Slc15a2'
ID177147
Institutional Source Beutler Lab
Gene Symbol Slc15a2
Ensembl Gene ENSMUSG00000022899
Gene Namesolute carrier family 15 (H+/peptide transporter), member 2
Synonyms8430408C16Rik, Pept2
MMRRC Submission 039608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1569 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location36750177-36784962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36756383 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 430 (T430A)
Ref Sequence ENSEMBL: ENSMUSP00000132663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000165380] [ENSMUST00000165531]
Predicted Effect probably benign
Transcript: ENSMUST00000023616
AA Change: T461A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: T461A

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 122 500 1.7e-122 PFAM
Pfam:PTR2 593 686 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164770
Predicted Effect probably benign
Transcript: ENSMUST00000165380
SMART Domains Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165531
AA Change: T430A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: T430A

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 99 469 2.4e-105 PFAM
PDB:2XUT|C 583 642 3e-10 PDB
transmembrane domain 655 677 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172382
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Atp6v0a4 A G 6: 38,050,625 V750A probably damaging Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Celsr3 A G 9: 108,829,068 T917A probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Fcrl1 A G 3: 87,384,705 Y57C probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lck C A 4: 129,555,656 D283Y probably damaging Het
Lcmt2 A G 2: 121,139,828 F258S probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Ppp1r18 A G 17: 35,868,703 E62G probably damaging Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Shbg T A 11: 69,617,589 probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Yes1 A G 5: 32,653,163 Y192C probably damaging Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp560 A T 9: 20,348,715 C284S possibly damaging Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Slc15a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Slc15a2 APN 16 36753775 missense probably benign 0.00
IGL00703:Slc15a2 APN 16 36757791 missense probably benign 0.00
IGL00937:Slc15a2 APN 16 36751880 nonsense probably null
IGL01511:Slc15a2 APN 16 36784726 missense probably damaging 0.99
IGL01739:Slc15a2 APN 16 36756230 missense probably benign
IGL02069:Slc15a2 APN 16 36759251 missense probably benign 0.02
IGL02076:Slc15a2 APN 16 36762381 missense probably damaging 1.00
IGL02254:Slc15a2 APN 16 36760087 missense possibly damaging 0.93
IGL02387:Slc15a2 APN 16 36751775 unclassified probably null
IGL02507:Slc15a2 APN 16 36781659 missense possibly damaging 0.87
IGL02829:Slc15a2 APN 16 36757193 missense possibly damaging 0.92
IGL03114:Slc15a2 APN 16 36751905 missense probably damaging 1.00
IGL03227:Slc15a2 APN 16 36756048 critical splice donor site probably null
PIT4581001:Slc15a2 UTSW 16 36772043 missense probably benign
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0083:Slc15a2 UTSW 16 36782283 missense probably damaging 1.00
R0099:Slc15a2 UTSW 16 36753036 missense probably damaging 1.00
R0104:Slc15a2 UTSW 16 36774635 missense possibly damaging 0.79
R0402:Slc15a2 UTSW 16 36775598 missense probably benign 0.00
R0619:Slc15a2 UTSW 16 36759307 missense probably damaging 1.00
R0963:Slc15a2 UTSW 16 36774573 missense probably damaging 1.00
R0972:Slc15a2 UTSW 16 36757139 missense probably benign 0.00
R1440:Slc15a2 UTSW 16 36784643 splice site probably benign
R1471:Slc15a2 UTSW 16 36753791 missense probably damaging 0.99
R1616:Slc15a2 UTSW 16 36754481 missense probably benign
R2246:Slc15a2 UTSW 16 36762361 missense probably damaging 1.00
R2405:Slc15a2 UTSW 16 36751837 nonsense probably null
R3834:Slc15a2 UTSW 16 36772128 nonsense probably null
R3835:Slc15a2 UTSW 16 36772128 nonsense probably null
R3885:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3887:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3888:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3889:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R4105:Slc15a2 UTSW 16 36782393 intron probably benign
R4108:Slc15a2 UTSW 16 36782393 intron probably benign
R4254:Slc15a2 UTSW 16 36754490 missense probably benign 0.04
R4352:Slc15a2 UTSW 16 36772028 missense probably benign 0.08
R4684:Slc15a2 UTSW 16 36757849 missense probably damaging 1.00
R4747:Slc15a2 UTSW 16 36772136 missense probably damaging 0.98
R4774:Slc15a2 UTSW 16 36781695 nonsense probably null
R5151:Slc15a2 UTSW 16 36752297 missense probably damaging 1.00
R5503:Slc15a2 UTSW 16 36762385 missense probably damaging 1.00
R5649:Slc15a2 UTSW 16 36772110 nonsense probably null
R6003:Slc15a2 UTSW 16 36754548 missense probably benign 0.00
R6261:Slc15a2 UTSW 16 36761611 missense probably benign 0.25
R6329:Slc15a2 UTSW 16 36751782 missense possibly damaging 0.94
R6409:Slc15a2 UTSW 16 36761870 missense probably benign 0.00
R6523:Slc15a2 UTSW 16 36752321 missense probably benign 0.17
R7125:Slc15a2 UTSW 16 36782298 missense probably damaging 1.00
R7208:Slc15a2 UTSW 16 36756281 missense probably benign 0.02
R7234:Slc15a2 UTSW 16 36757811 missense probably benign 0.05
R7374:Slc15a2 UTSW 16 36751845 missense probably benign 0.01
T0722:Slc15a2 UTSW 16 36772445 missense probably benign
V8831:Slc15a2 UTSW 16 36772445 missense probably benign
X0066:Slc15a2 UTSW 16 36753789 nonsense probably null
Z1088:Slc15a2 UTSW 16 36772445 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTCTGCCTGAACAGAACTTG -3'
(R):5'- TTGCAGTGTAAGCACGCCTACC -3'

Sequencing Primer
(F):5'- GCCTGAACAGAACTTGAACAATTTC -3'
(R):5'- acagattgttgtgagccacc -3'
Posted On2014-04-24