Incidental Mutation 'R1569:Ppp1r18'
ID177150
Institutional Source Beutler Lab
Gene Symbol Ppp1r18
Ensembl Gene ENSMUSG00000034595
Gene Nameprotein phosphatase 1, regulatory subunit 18
Synonyms2310014H01Rik
MMRRC Submission 039608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1569 (G1)
Quality Score193
Status Validated
Chromosome17
Chromosomal Location35865593-35875596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35868703 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 62 (E62G)
Ref Sequence ENSEMBL: ENSMUSP00000140652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074259] [ENSMUST00000113814] [ENSMUST00000122899] [ENSMUST00000127442] [ENSMUST00000144382] [ENSMUST00000174873] [ENSMUST00000187690] [ENSMUST00000190496]
Predicted Effect probably benign
Transcript: ENSMUST00000074259
SMART Domains Protein: ENSMUSP00000073873
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
low complexity region 212 234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113814
AA Change: E490G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109445
Gene: ENSMUSG00000034595
AA Change: E490G

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122899
AA Change: E490G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120343
Gene: ENSMUSG00000034595
AA Change: E490G

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127442
AA Change: E490G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115753
Gene: ENSMUSG00000034595
AA Change: E490G

DomainStartEndE-ValueType
Pfam:Phostensin_N 27 117 1.5e-39 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 540 6.9e-34 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144382
AA Change: E490G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116100
Gene: ENSMUSG00000034595
AA Change: E490G

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145804
Predicted Effect probably benign
Transcript: ENSMUST00000172931
SMART Domains Protein: ENSMUSP00000134569
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174873
SMART Domains Protein: ENSMUSP00000133355
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184224
Predicted Effect probably damaging
Transcript: ENSMUST00000187690
AA Change: E490G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141094
Gene: ENSMUSG00000034595
AA Change: E490G

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190496
AA Change: E62G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140652
Gene: ENSMUSG00000034595
AA Change: E62G

DomainStartEndE-ValueType
Pfam:Phostensin 1 113 3.6e-43 PFAM
low complexity region 132 145 N/A INTRINSIC
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase-1 (PP1; see MIM 176875) interacts with regulatory subunits that target the enzyme to different cellular locations and change its activity toward specific substrates. Phostensin is a regulatory subunit that targets PP1 to F-actin (see MIM 102610) cytoskeleton (Kao et al., 2007 [PubMed 17374523]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,797 K166* probably null Het
Abca2 T A 2: 25,439,185 N1012K probably benign Het
Ahnak T C 19: 9,004,094 V914A possibly damaging Het
Akap1 T A 11: 88,833,180 M833L probably benign Het
Atp2b1 T A 10: 98,987,326 H249Q probably benign Het
Atp6v0a4 A G 6: 38,050,625 V750A probably damaging Het
Car6 T C 4: 150,201,042 Y23C probably damaging Het
Celsr3 A G 9: 108,829,068 T917A probably damaging Het
Clmn C A 12: 104,781,081 D736Y probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dennd4c G A 4: 86,786,094 R282H possibly damaging Het
Dsg1b T A 18: 20,396,480 N327K probably damaging Het
Eftud2 A T 11: 102,854,771 probably benign Het
Esyt1 G T 10: 128,518,994 S512R possibly damaging Het
Fam124b T C 1: 80,213,135 Y177C possibly damaging Het
Fbxl5 A T 5: 43,765,461 I205K probably damaging Het
Fcrl1 A G 3: 87,384,705 Y57C probably damaging Het
Gabpb1 A T 2: 126,652,251 D151E probably benign Het
Gcc2 C T 10: 58,270,171 L310F probably benign Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Htr1b A G 9: 81,632,287 V89A probably benign Het
Ibsp A T 5: 104,310,151 T185S probably damaging Het
Igfn1 T C 1: 135,969,033 D1265G probably benign Het
Ints9 T C 14: 64,980,122 Y33H possibly damaging Het
Kif1a A T 1: 93,058,810 probably benign Het
Lama1 A T 17: 67,780,618 probably null Het
Lbp A T 2: 158,319,687 D223V probably damaging Het
Lck C A 4: 129,555,656 D283Y probably damaging Het
Lcmt2 A G 2: 121,139,828 F258S probably damaging Het
Lsg1 G T 16: 30,581,005 probably null Het
Maip1 T C 1: 57,413,395 probably benign Het
Mark3 T G 12: 111,633,746 I465S probably benign Het
Marveld2 C T 13: 100,600,998 V128I probably benign Het
Mcm3ap A G 10: 76,483,188 H750R possibly damaging Het
Mdn1 A T 4: 32,723,501 Q2479L probably null Het
Met A T 6: 17,531,504 K594* probably null Het
Pak2 G T 16: 32,037,295 S241R probably damaging Het
Plxna4 T C 6: 32,185,475 I1368V possibly damaging Het
Pparg T C 6: 115,439,999 I51T probably benign Het
Prkag2 T C 5: 24,947,477 S86G possibly damaging Het
Rabgap1l A T 1: 160,702,390 I347K probably benign Het
Rdh1 A T 10: 127,763,072 M141L probably benign Het
Rfx2 A T 17: 56,804,326 I82N possibly damaging Het
Sh2b2 G A 5: 136,231,735 A209V possibly damaging Het
Sh3d19 G A 3: 86,126,644 R768H possibly damaging Het
Sh3rf1 C T 8: 61,384,862 P814S probably damaging Het
Shbg T A 11: 69,617,589 probably benign Het
Slc15a2 T C 16: 36,756,383 T430A probably benign Het
Slc17a3 A T 13: 23,855,608 I250F probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 A G 2: 122,101,706 S552P probably damaging Het
Srpk2 A G 5: 23,514,026 I597T probably damaging Het
St6galnac1 T G 11: 116,769,271 N72T possibly damaging Het
Tecpr2 T A 12: 110,944,887 probably null Het
Tmem208 T A 8: 105,334,830 C163S possibly damaging Het
Tpte T C 8: 22,345,031 V401A probably damaging Het
Trhde A G 10: 114,446,188 W795R possibly damaging Het
Trpm3 G A 19: 22,889,445 probably null Het
Ttn T A 2: 76,795,719 T14999S possibly damaging Het
Txndc2 A T 17: 65,638,926 N85K probably benign Het
Yes1 A G 5: 32,653,163 Y192C probably damaging Het
Zan A G 5: 137,429,130 V2415A unknown Het
Zfp410 T A 12: 84,332,952 C311S probably damaging Het
Zfp51 A T 17: 21,456,380 M38L probably benign Het
Zfp560 A T 9: 20,348,715 C284S possibly damaging Het
Zfp808 C T 13: 62,172,900 R648* probably null Het
Zfp976 G T 7: 42,613,382 H344N probably damaging Het
Other mutations in Ppp1r18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02285:Ppp1r18 APN 17 35867256 missense probably damaging 1.00
IGL03188:Ppp1r18 APN 17 35867965 missense possibly damaging 0.94
IGL03339:Ppp1r18 APN 17 35868046 missense probably benign 0.00
R0098:Ppp1r18 UTSW 17 35867996 missense probably benign 0.31
R0098:Ppp1r18 UTSW 17 35867996 missense probably benign 0.31
R0310:Ppp1r18 UTSW 17 35873711 splice site probably benign
R1903:Ppp1r18 UTSW 17 35873846 missense probably damaging 0.98
R3038:Ppp1r18 UTSW 17 35868382 missense probably damaging 1.00
R3082:Ppp1r18 UTSW 17 35873850 missense probably damaging 1.00
R4513:Ppp1r18 UTSW 17 35868304 missense probably damaging 0.98
R5301:Ppp1r18 UTSW 17 35868345 missense probably benign 0.00
R5415:Ppp1r18 UTSW 17 35867619 missense probably benign 0.00
R5482:Ppp1r18 UTSW 17 35873879 missense probably damaging 1.00
R5707:Ppp1r18 UTSW 17 35867236 start codon destroyed probably null 0.99
R6235:Ppp1r18 UTSW 17 35873877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCTCCAGCATCTTCAGAGAAGC -3'
(R):5'- AGCAGTTGAGTGCAGAACAGAATCC -3'

Sequencing Primer
(F):5'- ACCCAGGACCTTCTGGTATG -3'
(R):5'- TGGCAAAGGAAGGCTACCC -3'
Posted On2014-04-24