Incidental Mutation 'R1570:Rnf25'
ID177157
Institutional Source Beutler Lab
Gene Symbol Rnf25
Ensembl Gene ENSMUSG00000026171
Gene Namering finger protein 25
Synonyms0610009H16Rik, AO7
MMRRC Submission 039609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1570 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74593748-74601397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74595267 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 199 (E199G)
Ref Sequence ENSEMBL: ENSMUSP00000109350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027357] [ENSMUST00000027358] [ENSMUST00000113721] [ENSMUST00000113732] [ENSMUST00000113733] [ENSMUST00000127938] [ENSMUST00000132081] [ENSMUST00000135140] [ENSMUST00000154874]
Predicted Effect probably damaging
Transcript: ENSMUST00000027357
AA Change: E200G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027357
Gene: ENSMUSG00000026171
AA Change: E200G

DomainStartEndE-ValueType
RWD 18 127 4.66e-31 SMART
RING 134 198 2.87e-5 SMART
low complexity region 368 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027358
SMART Domains Protein: ENSMUSP00000027358
Gene: ENSMUSG00000026172

DomainStartEndE-ValueType
BCS1_N 23 191 1.29e-86 SMART
AAA 222 357 3.23e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113721
AA Change: E199G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109350
Gene: ENSMUSG00000026171
AA Change: E199G

DomainStartEndE-ValueType
RWD 18 127 4.66e-31 SMART
RING 134 197 3.53e-5 SMART
low complexity region 367 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113732
SMART Domains Protein: ENSMUSP00000109361
Gene: ENSMUSG00000026172

DomainStartEndE-ValueType
BCS1_N 23 191 1.29e-86 SMART
AAA 222 357 3.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113733
SMART Domains Protein: ENSMUSP00000109362
Gene: ENSMUSG00000026172

DomainStartEndE-ValueType
BCS1_N 23 191 1.29e-86 SMART
AAA 222 357 3.23e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127938
AA Change: E89G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116973
Gene: ENSMUSG00000026171
AA Change: E89G

DomainStartEndE-ValueType
RING 23 87 2.87e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128491
Predicted Effect probably benign
Transcript: ENSMUST00000132081
Predicted Effect probably benign
Transcript: ENSMUST00000135140
Predicted Effect probably benign
Transcript: ENSMUST00000136078
SMART Domains Protein: ENSMUSP00000117692
Gene: ENSMUSG00000026171

DomainStartEndE-ValueType
RWD 24 123 1.97e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151003
Predicted Effect probably benign
Transcript: ENSMUST00000154874
SMART Domains Protein: ENSMUSP00000120646
Gene: ENSMUSG00000026171

DomainStartEndE-ValueType
RWD 1 94 6.36e-15 SMART
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency 93% (77/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif. The mouse counterpart of this protein has been shown to interact with Rela, the p65 subunit of NF-kappaB (NFKB), and modulate NFKB-mediated transcription activity. The mouse protein also binds ubiquitin-conjugating enzymes (E2s) and is a substrate for E2-dependent ubiquitination. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec1 A G 6: 122,591,085 probably null Het
Arhgap21 G T 2: 20,880,840 Q348K probably benign Het
Arl5c A G 11: 97,992,387 V129A probably benign Het
Armh1 A G 4: 117,229,992 S159P probably damaging Het
Asb8 A G 15: 98,136,428 L82P probably damaging Het
Bahcc1 G A 11: 120,272,183 A436T possibly damaging Het
Btc T C 5: 91,402,717 D2G unknown Het
C1s2 G A 6: 124,625,764 T490M probably benign Het
Caap1 C T 4: 94,556,577 G43D probably benign Het
Ccr5 T C 9: 124,124,963 V201A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdhr5 C A 7: 141,271,769 G541C probably damaging Het
Cep170 A G 1: 176,755,801 I1004T possibly damaging Het
Chd9 A T 8: 91,036,542 M2332L probably benign Het
Clk1 T A 1: 58,414,425 H334L probably benign Het
Cyp4b1 G A 4: 115,635,963 S228F probably benign Het
Dnah9 T C 11: 66,112,330 N883D probably benign Het
Dync2h1 A G 9: 7,176,926 L11P probably benign Het
Ephx4 A G 5: 107,419,851 E225G probably damaging Het
Erich6 C T 3: 58,630,659 probably null Het
Espl1 A G 15: 102,298,367 T89A probably damaging Het
Evi2 T A 11: 79,516,250 K166N possibly damaging Het
Glrx5 A G 12: 105,032,868 T57A possibly damaging Het
Gm15448 T C 7: 3,823,061 E311G probably benign Het
Gm884 A G 11: 103,609,938 Y597H possibly damaging Het
Gnptab T A 10: 88,419,454 V222E probably damaging Het
Gpr155 T C 2: 73,370,038 Y375C possibly damaging Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Ildr2 T C 1: 166,303,585 F337L probably damaging Het
Ino80 C T 2: 119,447,028 R322Q possibly damaging Het
Lcp2 A G 11: 34,089,601 D467G probably benign Het
Lmbr1 A G 5: 29,254,558 I229T probably damaging Het
Lnpep A T 17: 17,579,156 M79K probably damaging Het
Lpin1 T C 12: 16,560,998 Q564R possibly damaging Het
Lpin2 T A 17: 71,245,181 L794* probably null Het
Lrrc45 T C 11: 120,720,109 probably null Het
Mtus1 A G 8: 41,076,241 S751P probably damaging Het
Nbr1 T C 11: 101,564,830 probably benign Het
Nup107 A G 10: 117,763,844 F592S possibly damaging Het
Nup133 T A 8: 123,949,176 M1L possibly damaging Het
Olfr1104 A T 2: 87,022,272 S91T probably benign Het
Olfr1208 A C 2: 88,896,946 I217S probably damaging Het
Olfr139 A C 11: 74,044,807 F156V possibly damaging Het
Olfr434 T C 6: 43,217,351 V146A probably benign Het
Olfr548-ps1 C A 7: 102,541,970 H11Q probably damaging Het
Olfr732 T G 14: 50,281,524 H243P probably damaging Het
Otud7b T C 3: 96,155,891 C816R probably damaging Het
Pi4k2a T C 19: 42,100,644 V148A probably benign Het
Pih1d2 T C 9: 50,621,179 M195T probably benign Het
Plpp6 T C 19: 28,964,778 F260L probably damaging Het
R3hcc1l A T 19: 42,581,954 T663S probably damaging Het
Scin G A 12: 40,084,381 probably benign Het
Serpinb1c A T 13: 32,896,990 S37T probably benign Het
Snx19 A G 9: 30,428,343 D259G probably damaging Het
Sorcs3 A G 19: 48,764,181 K805R probably damaging Het
Sox6 C A 7: 115,777,123 G125W probably damaging Het
Spink5 A G 18: 43,967,107 I64V probably benign Het
St6galnac1 A G 11: 116,766,648 probably benign Het
Sult1c2 T C 17: 53,836,963 I105V probably benign Het
Tacr3 T G 3: 134,829,756 S162A probably damaging Het
Tex43 T A 18: 56,594,534 D101E probably benign Het
Ttc6 T C 12: 57,674,763 S1013P probably damaging Het
Zbtb11 C A 16: 55,990,815 N445K probably benign Het
Zfp423 A C 8: 87,782,558 V261G probably benign Het
Zfp59 T C 7: 27,853,591 V156A probably benign Het
Zscan2 C A 7: 80,863,393 A42E probably damaging Het
Other mutations in Rnf25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02542:Rnf25 APN 1 74594101 missense probably benign 0.02
IGL03268:Rnf25 APN 1 74599058 unclassified probably benign
R1740:Rnf25 UTSW 1 74598727 missense probably damaging 1.00
R2086:Rnf25 UTSW 1 74593967 missense probably damaging 0.99
R2939:Rnf25 UTSW 1 74595888 missense possibly damaging 0.50
R2940:Rnf25 UTSW 1 74595888 missense possibly damaging 0.50
R4556:Rnf25 UTSW 1 74599105 missense probably damaging 1.00
R4770:Rnf25 UTSW 1 74593940 missense probably damaging 1.00
R5075:Rnf25 UTSW 1 74595644 missense probably benign
R5394:Rnf25 UTSW 1 74595252 missense probably damaging 1.00
R6319:Rnf25 UTSW 1 74595731 missense probably damaging 1.00
R6960:Rnf25 UTSW 1 74595244 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTTGGACTTCTGAAGCCTTAGGCTC -3'
(R):5'- TGCAGCTTTGCAGCATTTCCAC -3'

Sequencing Primer
(F):5'- GGGAGGGGGAAGCTGTG -3'
(R):5'- ACGCCTCTCCTTAGGCAG -3'
Posted On2014-04-24