Incidental Mutation 'R1570:Olfr1104'
ID177163
Institutional Source Beutler Lab
Gene Symbol Olfr1104
Ensembl Gene ENSMUSG00000075166
Gene Nameolfactory receptor 1104
SynonymsGA_x6K02T2Q125-48508763-48507833, MOR207-1
MMRRC Submission 039609-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock #R1570 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87020703-87027080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87022272 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 91 (S91T)
Ref Sequence ENSEMBL: ENSMUSP00000149240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099869] [ENSMUST00000214857] [ENSMUST00000215972]
Predicted Effect probably benign
Transcript: ENSMUST00000099869
AA Change: S91T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097454
Gene: ENSMUSG00000075166
AA Change: S91T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 9.3e-48 PFAM
Pfam:7tm_1 41 289 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214857
AA Change: S91T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215972
AA Change: S91T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency 93% (77/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec1 A G 6: 122,591,085 probably null Het
Arhgap21 G T 2: 20,880,840 Q348K probably benign Het
Arl5c A G 11: 97,992,387 V129A probably benign Het
Armh1 A G 4: 117,229,992 S159P probably damaging Het
Asb8 A G 15: 98,136,428 L82P probably damaging Het
Bahcc1 G A 11: 120,272,183 A436T possibly damaging Het
Btc T C 5: 91,402,717 D2G unknown Het
C1s2 G A 6: 124,625,764 T490M probably benign Het
Caap1 C T 4: 94,556,577 G43D probably benign Het
Ccr5 T C 9: 124,124,963 V201A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdhr5 C A 7: 141,271,769 G541C probably damaging Het
Cep170 A G 1: 176,755,801 I1004T possibly damaging Het
Chd9 A T 8: 91,036,542 M2332L probably benign Het
Clk1 T A 1: 58,414,425 H334L probably benign Het
Cyp4b1 G A 4: 115,635,963 S228F probably benign Het
Dnah9 T C 11: 66,112,330 N883D probably benign Het
Dync2h1 A G 9: 7,176,926 L11P probably benign Het
Ephx4 A G 5: 107,419,851 E225G probably damaging Het
Erich6 C T 3: 58,630,659 probably null Het
Espl1 A G 15: 102,298,367 T89A probably damaging Het
Evi2 T A 11: 79,516,250 K166N possibly damaging Het
Glrx5 A G 12: 105,032,868 T57A possibly damaging Het
Gm15448 T C 7: 3,823,061 E311G probably benign Het
Gm884 A G 11: 103,609,938 Y597H possibly damaging Het
Gnptab T A 10: 88,419,454 V222E probably damaging Het
Gpr155 T C 2: 73,370,038 Y375C possibly damaging Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Ildr2 T C 1: 166,303,585 F337L probably damaging Het
Ino80 C T 2: 119,447,028 R322Q possibly damaging Het
Lcp2 A G 11: 34,089,601 D467G probably benign Het
Lmbr1 A G 5: 29,254,558 I229T probably damaging Het
Lnpep A T 17: 17,579,156 M79K probably damaging Het
Lpin1 T C 12: 16,560,998 Q564R possibly damaging Het
Lpin2 T A 17: 71,245,181 L794* probably null Het
Lrrc45 T C 11: 120,720,109 probably null Het
Mtus1 A G 8: 41,076,241 S751P probably damaging Het
Nbr1 T C 11: 101,564,830 probably benign Het
Nup107 A G 10: 117,763,844 F592S possibly damaging Het
Nup133 T A 8: 123,949,176 M1L possibly damaging Het
Olfr1208 A C 2: 88,896,946 I217S probably damaging Het
Olfr139 A C 11: 74,044,807 F156V possibly damaging Het
Olfr434 T C 6: 43,217,351 V146A probably benign Het
Olfr548-ps1 C A 7: 102,541,970 H11Q probably damaging Het
Olfr732 T G 14: 50,281,524 H243P probably damaging Het
Otud7b T C 3: 96,155,891 C816R probably damaging Het
Pi4k2a T C 19: 42,100,644 V148A probably benign Het
Pih1d2 T C 9: 50,621,179 M195T probably benign Het
Plpp6 T C 19: 28,964,778 F260L probably damaging Het
R3hcc1l A T 19: 42,581,954 T663S probably damaging Het
Rnf25 T C 1: 74,595,267 E199G probably damaging Het
Scin G A 12: 40,084,381 probably benign Het
Serpinb1c A T 13: 32,896,990 S37T probably benign Het
Snx19 A G 9: 30,428,343 D259G probably damaging Het
Sorcs3 A G 19: 48,764,181 K805R probably damaging Het
Sox6 C A 7: 115,777,123 G125W probably damaging Het
Spink5 A G 18: 43,967,107 I64V probably benign Het
St6galnac1 A G 11: 116,766,648 probably benign Het
Sult1c2 T C 17: 53,836,963 I105V probably benign Het
Tacr3 T G 3: 134,829,756 S162A probably damaging Het
Tex43 T A 18: 56,594,534 D101E probably benign Het
Ttc6 T C 12: 57,674,763 S1013P probably damaging Het
Zbtb11 C A 16: 55,990,815 N445K probably benign Het
Zfp423 A C 8: 87,782,558 V261G probably benign Het
Zfp59 T C 7: 27,853,591 V156A probably benign Het
Zscan2 C A 7: 80,863,393 A42E probably damaging Het
Other mutations in Olfr1104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1104 APN 2 87021884 missense probably damaging 1.00
IGL02533:Olfr1104 APN 2 87022353 missense probably damaging 1.00
IGL02662:Olfr1104 APN 2 87022002 missense probably benign 0.09
IGL02704:Olfr1104 APN 2 87022277 missense probably benign 0.00
R0145:Olfr1104 UTSW 2 87021790 nonsense probably null
R0625:Olfr1104 UTSW 2 87021620 missense probably benign
R1169:Olfr1104 UTSW 2 87021717 missense probably damaging 1.00
R1727:Olfr1104 UTSW 2 87022263 missense probably damaging 1.00
R2146:Olfr1104 UTSW 2 87021665 missense probably damaging 1.00
R2192:Olfr1104 UTSW 2 87022511 missense probably benign 0.01
R3716:Olfr1104 UTSW 2 87022363 nonsense probably null
R3818:Olfr1104 UTSW 2 87021710 missense probably benign 0.02
R4711:Olfr1104 UTSW 2 87022026 missense probably damaging 1.00
R6104:Olfr1104 UTSW 2 87021713 missense probably damaging 1.00
R6482:Olfr1104 UTSW 2 87022525 missense probably benign 0.00
R7474:Olfr1104 UTSW 2 87022554 start gained probably benign
R7517:Olfr1104 UTSW 2 87022142 missense not run
X0019:Olfr1104 UTSW 2 87021635 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTACTGCCAGCCAGTTGCACACC -3'
(R):5'- TAATGCTGGAGGACAAGCAGTCCC -3'

Sequencing Primer
(F):5'- AGTTGCACACCTTCTGGGAC -3'
(R):5'- CAGTGGATTTTCAGATCACCCAG -3'
Posted On2014-04-24