Incidental Mutation 'R1570:Erich6'
ID177166
Institutional Source Beutler Lab
Gene Symbol Erich6
Ensembl Gene ENSMUSG00000070471
Gene Nameglutamate rich 6
SynonymsFam194a, 4932431H17Rik
MMRRC Submission 039609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1570 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location58616300-58637207 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 58630659 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041115] [ENSMUST00000041115]
Predicted Effect probably null
Transcript: ENSMUST00000041115
SMART Domains Protein: ENSMUSP00000040882
Gene: ENSMUSG00000070471

DomainStartEndE-ValueType
coiled coil region 27 77 N/A INTRINSIC
low complexity region 164 174 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
Pfam:FAM194 473 675 5.4e-67 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041115
SMART Domains Protein: ENSMUSP00000040882
Gene: ENSMUSG00000070471

DomainStartEndE-ValueType
coiled coil region 27 77 N/A INTRINSIC
low complexity region 164 174 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
Pfam:FAM194 473 675 5.4e-67 PFAM
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency 93% (77/83)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec1 A G 6: 122,591,085 probably null Het
Arhgap21 G T 2: 20,880,840 Q348K probably benign Het
Arl5c A G 11: 97,992,387 V129A probably benign Het
Armh1 A G 4: 117,229,992 S159P probably damaging Het
Asb8 A G 15: 98,136,428 L82P probably damaging Het
Bahcc1 G A 11: 120,272,183 A436T possibly damaging Het
Btc T C 5: 91,402,717 D2G unknown Het
C1s2 G A 6: 124,625,764 T490M probably benign Het
Caap1 C T 4: 94,556,577 G43D probably benign Het
Ccr5 T C 9: 124,124,963 V201A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdhr5 C A 7: 141,271,769 G541C probably damaging Het
Cep170 A G 1: 176,755,801 I1004T possibly damaging Het
Chd9 A T 8: 91,036,542 M2332L probably benign Het
Clk1 T A 1: 58,414,425 H334L probably benign Het
Cyp4b1 G A 4: 115,635,963 S228F probably benign Het
Dnah9 T C 11: 66,112,330 N883D probably benign Het
Dync2h1 A G 9: 7,176,926 L11P probably benign Het
Ephx4 A G 5: 107,419,851 E225G probably damaging Het
Espl1 A G 15: 102,298,367 T89A probably damaging Het
Evi2 T A 11: 79,516,250 K166N possibly damaging Het
Glrx5 A G 12: 105,032,868 T57A possibly damaging Het
Gm15448 T C 7: 3,823,061 E311G probably benign Het
Gm884 A G 11: 103,609,938 Y597H possibly damaging Het
Gnptab T A 10: 88,419,454 V222E probably damaging Het
Gpr155 T C 2: 73,370,038 Y375C possibly damaging Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Ildr2 T C 1: 166,303,585 F337L probably damaging Het
Ino80 C T 2: 119,447,028 R322Q possibly damaging Het
Lcp2 A G 11: 34,089,601 D467G probably benign Het
Lmbr1 A G 5: 29,254,558 I229T probably damaging Het
Lnpep A T 17: 17,579,156 M79K probably damaging Het
Lpin1 T C 12: 16,560,998 Q564R possibly damaging Het
Lpin2 T A 17: 71,245,181 L794* probably null Het
Lrrc45 T C 11: 120,720,109 probably null Het
Mtus1 A G 8: 41,076,241 S751P probably damaging Het
Nbr1 T C 11: 101,564,830 probably benign Het
Nup107 A G 10: 117,763,844 F592S possibly damaging Het
Nup133 T A 8: 123,949,176 M1L possibly damaging Het
Olfr1104 A T 2: 87,022,272 S91T probably benign Het
Olfr1208 A C 2: 88,896,946 I217S probably damaging Het
Olfr139 A C 11: 74,044,807 F156V possibly damaging Het
Olfr434 T C 6: 43,217,351 V146A probably benign Het
Olfr548-ps1 C A 7: 102,541,970 H11Q probably damaging Het
Olfr732 T G 14: 50,281,524 H243P probably damaging Het
Otud7b T C 3: 96,155,891 C816R probably damaging Het
Pi4k2a T C 19: 42,100,644 V148A probably benign Het
Pih1d2 T C 9: 50,621,179 M195T probably benign Het
Plpp6 T C 19: 28,964,778 F260L probably damaging Het
R3hcc1l A T 19: 42,581,954 T663S probably damaging Het
Rnf25 T C 1: 74,595,267 E199G probably damaging Het
Scin G A 12: 40,084,381 probably benign Het
Serpinb1c A T 13: 32,896,990 S37T probably benign Het
Snx19 A G 9: 30,428,343 D259G probably damaging Het
Sorcs3 A G 19: 48,764,181 K805R probably damaging Het
Sox6 C A 7: 115,777,123 G125W probably damaging Het
Spink5 A G 18: 43,967,107 I64V probably benign Het
St6galnac1 A G 11: 116,766,648 probably benign Het
Sult1c2 T C 17: 53,836,963 I105V probably benign Het
Tacr3 T G 3: 134,829,756 S162A probably damaging Het
Tex43 T A 18: 56,594,534 D101E probably benign Het
Ttc6 T C 12: 57,674,763 S1013P probably damaging Het
Zbtb11 C A 16: 55,990,815 N445K probably benign Het
Zfp423 A C 8: 87,782,558 V261G probably benign Het
Zfp59 T C 7: 27,853,591 V156A probably benign Het
Zscan2 C A 7: 80,863,393 A42E probably damaging Het
Other mutations in Erich6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Erich6 APN 3 58637043 missense unknown
IGL01352:Erich6 APN 3 58622360 splice site probably null
IGL01362:Erich6 APN 3 58622360 splice site probably null
IGL01928:Erich6 APN 3 58621271 missense probably damaging 1.00
IGL02930:Erich6 APN 3 58622354 splice site probably benign
IGL03125:Erich6 APN 3 58624306 missense probably benign 0.00
PIT4243001:Erich6 UTSW 3 58629879 missense possibly damaging 0.51
R0081:Erich6 UTSW 3 58636126 splice site probably benign
R0129:Erich6 UTSW 3 58624378 missense probably damaging 1.00
R0308:Erich6 UTSW 3 58636104 missense probably damaging 1.00
R0682:Erich6 UTSW 3 58636811 missense probably benign 0.39
R0734:Erich6 UTSW 3 58629388 splice site probably benign
R0744:Erich6 UTSW 3 58636122 splice site probably benign
R0833:Erich6 UTSW 3 58618944 splice site probably benign
R0836:Erich6 UTSW 3 58618944 splice site probably benign
R1385:Erich6 UTSW 3 58636830 missense probably benign 0.00
R1536:Erich6 UTSW 3 58626598 missense probably benign 0.01
R1708:Erich6 UTSW 3 58616447 missense probably benign 0.21
R2187:Erich6 UTSW 3 58629845 critical splice donor site probably null
R2268:Erich6 UTSW 3 58618839 missense probably benign 0.03
R2441:Erich6 UTSW 3 58618811 missense probably damaging 1.00
R3803:Erich6 UTSW 3 58621332 missense probably damaging 1.00
R3981:Erich6 UTSW 3 58636704 missense probably benign 0.41
R4166:Erich6 UTSW 3 58618808 missense probably damaging 1.00
R4298:Erich6 UTSW 3 58624291 missense probably benign 0.09
R4729:Erich6 UTSW 3 58636059 critical splice donor site probably null
R4838:Erich6 UTSW 3 58636830 missense probably benign 0.00
R5117:Erich6 UTSW 3 58623205 missense probably benign 0.00
R5305:Erich6 UTSW 3 58625116 missense probably benign 0.21
R5546:Erich6 UTSW 3 58618797 missense probably benign 0.39
R5605:Erich6 UTSW 3 58625119 missense probably damaging 1.00
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6378:Erich6 UTSW 3 58622359 splice site probably null
R6606:Erich6 UTSW 3 58616500 missense probably damaging 1.00
R6736:Erich6 UTSW 3 58625054 missense probably damaging 1.00
R6746:Erich6 UTSW 3 58616566 missense possibly damaging 0.69
R6974:Erich6 UTSW 3 58618799 missense probably benign 0.06
R6996:Erich6 UTSW 3 58636095 missense probably damaging 1.00
R7317:Erich6 UTSW 3 58636884 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGTTTCTCGGCTAACAGATGCTGC -3'
(R):5'- TGACCCAAAAGGCCAGTTCTCCTC -3'

Sequencing Primer
(F):5'- CTGCTGAGGTTAACAAAGTTGCC -3'
(R):5'- CATCAGAACTTTCGATGGGC -3'
Posted On2014-04-24