Incidental Mutation 'R1570:Apobec1'
ID177176
Institutional Source Beutler Lab
Gene Symbol Apobec1
Ensembl Gene ENSMUSG00000040613
Gene Nameapolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Synonyms
MMRRC Submission 039609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1570 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122577792-122602444 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 122591085 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112585] [ENSMUST00000112586] [ENSMUST00000112587] [ENSMUST00000112587] [ENSMUST00000147760] [ENSMUST00000147760] [ENSMUST00000203197] [ENSMUST00000203197] [ENSMUST00000203204] [ENSMUST00000203204] [ENSMUST00000203309] [ENSMUST00000203309]
Predicted Effect probably null
Transcript: ENSMUST00000112585
SMART Domains Protein: ENSMUSP00000108204
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 15 181 3.6e-38 PFAM
Pfam:APOBEC_C 124 178 9.5e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112586
SMART Domains Protein: ENSMUSP00000108205
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 15 181 3.6e-38 PFAM
Pfam:APOBEC_C 124 178 9.5e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112587
SMART Domains Protein: ENSMUSP00000108206
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 177 1.7e-32 PFAM
Pfam:APOBEC_C 125 179 3.8e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112587
SMART Domains Protein: ENSMUSP00000108206
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 177 1.7e-32 PFAM
Pfam:APOBEC_C 125 179 3.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143356
Predicted Effect probably null
Transcript: ENSMUST00000147760
Predicted Effect probably null
Transcript: ENSMUST00000147760
Predicted Effect probably null
Transcript: ENSMUST00000203197
Predicted Effect probably null
Transcript: ENSMUST00000203197
Predicted Effect probably null
Transcript: ENSMUST00000203204
SMART Domains Protein: ENSMUSP00000145154
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 113 1e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203204
SMART Domains Protein: ENSMUSP00000145154
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 113 1e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203309
SMART Domains Protein: ENSMUSP00000145417
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 121 1.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203309
SMART Domains Protein: ENSMUSP00000145417
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 121 1.6e-17 PFAM
Meta Mutation Damage Score 0.542 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency 93% (77/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytidine deaminase enzyme family. The encoded protein forms a multiple-protein editing holoenzyme with APOBEC1 complementation factor (ACF) and APOBEC1 stimulating protein (ASP). This holoenzyme is involved in the editing of C-to-U nucleotide bases in apolipoprotein B and neurofibromatosis-1 mRNAs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G T 2: 20,880,840 Q348K probably benign Het
Arl5c A G 11: 97,992,387 V129A probably benign Het
Armh1 A G 4: 117,229,992 S159P probably damaging Het
Asb8 A G 15: 98,136,428 L82P probably damaging Het
Bahcc1 G A 11: 120,272,183 A436T possibly damaging Het
Btc T C 5: 91,402,717 D2G unknown Het
C1s2 G A 6: 124,625,764 T490M probably benign Het
Caap1 C T 4: 94,556,577 G43D probably benign Het
Ccr5 T C 9: 124,124,963 V201A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdhr5 C A 7: 141,271,769 G541C probably damaging Het
Cep170 A G 1: 176,755,801 I1004T possibly damaging Het
Chd9 A T 8: 91,036,542 M2332L probably benign Het
Clk1 T A 1: 58,414,425 H334L probably benign Het
Cyp4b1 G A 4: 115,635,963 S228F probably benign Het
Dnah9 T C 11: 66,112,330 N883D probably benign Het
Dync2h1 A G 9: 7,176,926 L11P probably benign Het
Ephx4 A G 5: 107,419,851 E225G probably damaging Het
Erich6 C T 3: 58,630,659 probably null Het
Espl1 A G 15: 102,298,367 T89A probably damaging Het
Evi2 T A 11: 79,516,250 K166N possibly damaging Het
Glrx5 A G 12: 105,032,868 T57A possibly damaging Het
Gm15448 T C 7: 3,823,061 E311G probably benign Het
Gm884 A G 11: 103,609,938 Y597H possibly damaging Het
Gnptab T A 10: 88,419,454 V222E probably damaging Het
Gpr155 T C 2: 73,370,038 Y375C possibly damaging Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Ildr2 T C 1: 166,303,585 F337L probably damaging Het
Ino80 C T 2: 119,447,028 R322Q possibly damaging Het
Lcp2 A G 11: 34,089,601 D467G probably benign Het
Lmbr1 A G 5: 29,254,558 I229T probably damaging Het
Lnpep A T 17: 17,579,156 M79K probably damaging Het
Lpin1 T C 12: 16,560,998 Q564R possibly damaging Het
Lpin2 T A 17: 71,245,181 L794* probably null Het
Lrrc45 T C 11: 120,720,109 probably null Het
Mtus1 A G 8: 41,076,241 S751P probably damaging Het
Nbr1 T C 11: 101,564,830 probably benign Het
Nup107 A G 10: 117,763,844 F592S possibly damaging Het
Nup133 T A 8: 123,949,176 M1L possibly damaging Het
Olfr1104 A T 2: 87,022,272 S91T probably benign Het
Olfr1208 A C 2: 88,896,946 I217S probably damaging Het
Olfr139 A C 11: 74,044,807 F156V possibly damaging Het
Olfr434 T C 6: 43,217,351 V146A probably benign Het
Olfr548-ps1 C A 7: 102,541,970 H11Q probably damaging Het
Olfr732 T G 14: 50,281,524 H243P probably damaging Het
Otud7b T C 3: 96,155,891 C816R probably damaging Het
Pi4k2a T C 19: 42,100,644 V148A probably benign Het
Pih1d2 T C 9: 50,621,179 M195T probably benign Het
Plpp6 T C 19: 28,964,778 F260L probably damaging Het
R3hcc1l A T 19: 42,581,954 T663S probably damaging Het
Rnf25 T C 1: 74,595,267 E199G probably damaging Het
Scin G A 12: 40,084,381 probably benign Het
Serpinb1c A T 13: 32,896,990 S37T probably benign Het
Snx19 A G 9: 30,428,343 D259G probably damaging Het
Sorcs3 A G 19: 48,764,181 K805R probably damaging Het
Sox6 C A 7: 115,777,123 G125W probably damaging Het
Spink5 A G 18: 43,967,107 I64V probably benign Het
St6galnac1 A G 11: 116,766,648 probably benign Het
Sult1c2 T C 17: 53,836,963 I105V probably benign Het
Tacr3 T G 3: 134,829,756 S162A probably damaging Het
Tex43 T A 18: 56,594,534 D101E probably benign Het
Ttc6 T C 12: 57,674,763 S1013P probably damaging Het
Zbtb11 C A 16: 55,990,815 N445K probably benign Het
Zfp423 A C 8: 87,782,558 V261G probably benign Het
Zfp59 T C 7: 27,853,591 V156A probably benign Het
Zscan2 C A 7: 80,863,393 A42E probably damaging Het
Other mutations in Apobec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Apobec1 APN 6 122588179 splice site probably benign
IGL02420:Apobec1 APN 6 122581572 missense probably benign 0.00
R0523:Apobec1 UTSW 6 122581545 missense probably damaging 1.00
R1823:Apobec1 UTSW 6 122578886 missense possibly damaging 0.77
R4572:Apobec1 UTSW 6 122581397 missense probably damaging 0.99
R5050:Apobec1 UTSW 6 122591102 start codon destroyed probably null 0.18
R5454:Apobec1 UTSW 6 122581368 missense probably benign 0.30
R5642:Apobec1 UTSW 6 122581497 missense probably damaging 1.00
R5898:Apobec1 UTSW 6 122580773 missense probably damaging 1.00
R6381:Apobec1 UTSW 6 122578931 missense probably damaging 1.00
R6736:Apobec1 UTSW 6 122581675 missense probably null
R6894:Apobec1 UTSW 6 122591242 intron probably benign
R7488:Apobec1 UTSW 6 122581562 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATGAGCAGGTCAGACCCACATAC -3'
(R):5'- ATCCAGATGCCACTTCCTTCTTC -3'

Sequencing Primer
(F):5'- CACCTGATGCACTCTTCAAG -3'
(R):5'- CAGATCTCAAGTTGCTACTG -3'
Genotyping

R1570:Apobec1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R15700024_Apobec1_PCR_F: 5’- TGATGCACTCTTCAAGACCACAGAC-3’

R15700024_Apobec1_PCR_R: 5’- GGGAGGACAAATATCCAGATGCCAC-3’

 

Sequencing Primers

R15700024_Apobec1_SEQ_F: 5’- ttcaagaccacagacccaag-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 429 nucleotides is amplified (Chr.6: 122590877-122591305, GRCm38; NCBI RefSeq: NC_000072):

 

tgatgcactc ttcaagacca cagacccaag ctaagcgtgg gagcaggcgt ttgtattccg       

agacacttaa ggggttaaat gaagcaggag gataacctgg ggccagcagc tgggggccag      

cctggggtag catgataaac tgtagagtaa gaagcaaagt aaagaggaaa catcaactca      

acaccttgct agaacccggc atccctttac ctgtctcgga actcatcttg ctctgtctct      

ggacgccttc ctcgggagct tatgttgctg cgatggcttc tgccagctgt gtgccggact      

ttgtttcctc aggtgtgccc acagccacct gcagggacac ggggtgactc attcctgagc      

gtcagtagca acttgagatc tgtactatgt aaatgaagaa ggaagtggca tctggatatt      

tgtcctccc

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated T is shown in red text (Chr. + strand, A>G; Sense strand, T>C).

Posted On2014-04-24