Incidental Mutation 'R1570:Zfp423'
ID177186
Institutional Source Beutler Lab
Gene Symbol Zfp423
Ensembl Gene ENSMUSG00000045333
Gene Namezinc finger protein 423
SynonymsZfp104, ataxia1, Ebfaz, Roaz
MMRRC Submission 039609-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R1570 (G1)
Quality Score86
Status Validated
Chromosome8
Chromosomal Location87661810-87959595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87782558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 261 (V261G)
Ref Sequence ENSEMBL: ENSMUSP00000129724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052250] [ENSMUST00000109655] [ENSMUST00000165770] [ENSMUST00000174249] [ENSMUST00000174764]
Predicted Effect probably benign
Transcript: ENSMUST00000052250
AA Change: V365G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052379
Gene: ENSMUSG00000045333
AA Change: V365G

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
ZnF_C2H2 54 75 5.07e0 SMART
low complexity region 107 123 N/A INTRINSIC
ZnF_C2H2 125 147 1.28e-3 SMART
ZnF_C2H2 153 175 1.64e-1 SMART
ZnF_C2H2 181 203 2.05e-2 SMART
ZnF_C2H2 209 231 3.21e-4 SMART
ZnF_C2H2 250 273 5.42e-2 SMART
ZnF_C2H2 282 305 1.76e-1 SMART
ZnF_C2H2 310 332 8.67e-1 SMART
low complexity region 350 364 N/A INTRINSIC
ZnF_C2H2 396 420 1.16e-1 SMART
ZnF_C2H2 428 451 3.52e-1 SMART
ZnF_C2H2 467 490 7.9e-4 SMART
low complexity region 492 503 N/A INTRINSIC
ZnF_C2H2 504 527 2.53e-2 SMART
ZnF_C2H2 550 575 3.99e0 SMART
low complexity region 591 602 N/A INTRINSIC
ZnF_C2H2 619 641 3.16e-3 SMART
ZnF_C2H2 649 671 5.81e-2 SMART
ZnF_C2H2 679 702 4.87e-4 SMART
ZnF_C2H2 707 730 7.26e-3 SMART
ZnF_C2H2 737 760 4.79e-3 SMART
ZnF_C2H2 768 790 1.36e-2 SMART
ZnF_C2H2 794 817 4.72e-2 SMART
ZnF_C2H2 873 896 4.12e0 SMART
ZnF_C2H2 917 939 5.59e-4 SMART
ZnF_C2H2 946 968 6.42e-4 SMART
ZnF_C2H2 975 997 4.94e0 SMART
ZnF_C2H2 1007 1029 4.99e1 SMART
Pfam:zf-C2H2_6 1050 1068 1.6e-1 PFAM
ZnF_C2H2 1107 1130 1.12e-3 SMART
ZnF_C2H2 1155 1177 1.45e-2 SMART
ZnF_C2H2 1185 1207 5.72e-1 SMART
ZnF_C2H2 1216 1239 1.18e-2 SMART
ZnF_C2H2 1246 1269 4.05e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109655
AA Change: V386G

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105282
Gene: ENSMUSG00000045333
AA Change: V386G

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
ZnF_C2H2 75 96 5.07e0 SMART
low complexity region 128 144 N/A INTRINSIC
ZnF_C2H2 146 168 1.28e-3 SMART
ZnF_C2H2 174 196 1.64e-1 SMART
ZnF_C2H2 202 224 2.05e-2 SMART
ZnF_C2H2 230 252 3.21e-4 SMART
ZnF_C2H2 271 294 5.42e-2 SMART
ZnF_C2H2 303 326 1.76e-1 SMART
ZnF_C2H2 331 353 8.67e-1 SMART
low complexity region 371 385 N/A INTRINSIC
ZnF_C2H2 417 441 1.16e-1 SMART
ZnF_C2H2 449 472 3.52e-1 SMART
ZnF_C2H2 488 511 7.9e-4 SMART
low complexity region 513 524 N/A INTRINSIC
ZnF_C2H2 525 548 2.53e-2 SMART
ZnF_C2H2 571 596 3.99e0 SMART
low complexity region 612 623 N/A INTRINSIC
ZnF_C2H2 640 662 3.16e-3 SMART
ZnF_C2H2 670 692 5.81e-2 SMART
ZnF_C2H2 700 723 4.87e-4 SMART
ZnF_C2H2 728 751 7.26e-3 SMART
ZnF_C2H2 758 781 4.79e-3 SMART
ZnF_C2H2 789 811 1.36e-2 SMART
ZnF_C2H2 815 838 4.72e-2 SMART
ZnF_C2H2 894 917 4.12e0 SMART
ZnF_C2H2 938 960 5.59e-4 SMART
ZnF_C2H2 967 989 6.42e-4 SMART
ZnF_C2H2 996 1018 4.94e0 SMART
ZnF_C2H2 1028 1050 4.99e1 SMART
ZnF_C2H2 1128 1151 1.12e-3 SMART
ZnF_C2H2 1176 1198 1.45e-2 SMART
ZnF_C2H2 1206 1228 5.72e-1 SMART
ZnF_C2H2 1237 1260 1.18e-2 SMART
ZnF_C2H2 1267 1290 4.05e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165770
AA Change: V261G

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129724
Gene: ENSMUSG00000045333
AA Change: V261G

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
ZnF_C2H2 21 43 1.28e-3 SMART
ZnF_C2H2 49 71 1.64e-1 SMART
ZnF_C2H2 77 99 2.05e-2 SMART
ZnF_C2H2 105 127 3.21e-4 SMART
ZnF_C2H2 146 169 5.42e-2 SMART
ZnF_C2H2 178 201 1.76e-1 SMART
ZnF_C2H2 206 228 8.67e-1 SMART
low complexity region 246 260 N/A INTRINSIC
ZnF_C2H2 292 316 1.16e-1 SMART
ZnF_C2H2 324 347 3.52e-1 SMART
ZnF_C2H2 363 386 7.9e-4 SMART
low complexity region 388 399 N/A INTRINSIC
ZnF_C2H2 400 423 2.53e-2 SMART
ZnF_C2H2 446 471 3.99e0 SMART
low complexity region 487 498 N/A INTRINSIC
ZnF_C2H2 515 537 3.16e-3 SMART
ZnF_C2H2 545 567 5.81e-2 SMART
ZnF_C2H2 575 598 4.87e-4 SMART
ZnF_C2H2 603 626 7.26e-3 SMART
ZnF_C2H2 633 656 4.79e-3 SMART
ZnF_C2H2 664 686 1.36e-2 SMART
ZnF_C2H2 690 713 4.72e-2 SMART
ZnF_C2H2 769 792 4.12e0 SMART
ZnF_C2H2 813 835 5.59e-4 SMART
ZnF_C2H2 842 864 6.42e-4 SMART
ZnF_C2H2 871 893 4.94e0 SMART
ZnF_C2H2 903 925 4.99e1 SMART
Pfam:zf-C2H2_6 946 964 2.5e-1 PFAM
ZnF_C2H2 1003 1026 1.12e-3 SMART
ZnF_C2H2 1051 1073 1.45e-2 SMART
ZnF_C2H2 1081 1103 5.72e-1 SMART
ZnF_C2H2 1112 1135 1.18e-2 SMART
ZnF_C2H2 1142 1165 4.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173725
Predicted Effect probably benign
Transcript: ENSMUST00000174249
SMART Domains Protein: ENSMUSP00000134103
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
ZnF_C2H2 78 100 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174764
SMART Domains Protein: ENSMUSP00000134575
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
ZnF_C2H2 78 99 5.07e0 SMART
low complexity region 131 147 N/A INTRINSIC
ZnF_C2H2 149 171 1.28e-3 SMART
ZnF_C2H2 177 199 1.64e-1 SMART
ZnF_C2H2 205 227 2.05e-2 SMART
Pfam:zf-C2H2_6 232 244 2.5e-1 PFAM
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency 93% (77/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mutations in this gene lead to postnatal lethality, abnormal gait, ataxia, reduced body size, loss of the corpus callosum, reduction of the hippocampus, olfactory bulb defects, and variable malformation of the cerebellum, including vermis agenesis, due to reduced proliferation of neural precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec1 A G 6: 122,591,085 probably null Het
Arhgap21 G T 2: 20,880,840 Q348K probably benign Het
Arl5c A G 11: 97,992,387 V129A probably benign Het
Armh1 A G 4: 117,229,992 S159P probably damaging Het
Asb8 A G 15: 98,136,428 L82P probably damaging Het
Bahcc1 G A 11: 120,272,183 A436T possibly damaging Het
Btc T C 5: 91,402,717 D2G unknown Het
C1s2 G A 6: 124,625,764 T490M probably benign Het
Caap1 C T 4: 94,556,577 G43D probably benign Het
Ccr5 T C 9: 124,124,963 V201A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdhr5 C A 7: 141,271,769 G541C probably damaging Het
Cep170 A G 1: 176,755,801 I1004T possibly damaging Het
Chd9 A T 8: 91,036,542 M2332L probably benign Het
Clk1 T A 1: 58,414,425 H334L probably benign Het
Cyp4b1 G A 4: 115,635,963 S228F probably benign Het
Dnah9 T C 11: 66,112,330 N883D probably benign Het
Dync2h1 A G 9: 7,176,926 L11P probably benign Het
Ephx4 A G 5: 107,419,851 E225G probably damaging Het
Erich6 C T 3: 58,630,659 probably null Het
Espl1 A G 15: 102,298,367 T89A probably damaging Het
Evi2 T A 11: 79,516,250 K166N possibly damaging Het
Glrx5 A G 12: 105,032,868 T57A possibly damaging Het
Gm15448 T C 7: 3,823,061 E311G probably benign Het
Gm884 A G 11: 103,609,938 Y597H possibly damaging Het
Gnptab T A 10: 88,419,454 V222E probably damaging Het
Gpr155 T C 2: 73,370,038 Y375C possibly damaging Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Ildr2 T C 1: 166,303,585 F337L probably damaging Het
Ino80 C T 2: 119,447,028 R322Q possibly damaging Het
Lcp2 A G 11: 34,089,601 D467G probably benign Het
Lmbr1 A G 5: 29,254,558 I229T probably damaging Het
Lnpep A T 17: 17,579,156 M79K probably damaging Het
Lpin1 T C 12: 16,560,998 Q564R possibly damaging Het
Lpin2 T A 17: 71,245,181 L794* probably null Het
Lrrc45 T C 11: 120,720,109 probably null Het
Mtus1 A G 8: 41,076,241 S751P probably damaging Het
Nbr1 T C 11: 101,564,830 probably benign Het
Nup107 A G 10: 117,763,844 F592S possibly damaging Het
Nup133 T A 8: 123,949,176 M1L possibly damaging Het
Olfr1104 A T 2: 87,022,272 S91T probably benign Het
Olfr1208 A C 2: 88,896,946 I217S probably damaging Het
Olfr139 A C 11: 74,044,807 F156V possibly damaging Het
Olfr434 T C 6: 43,217,351 V146A probably benign Het
Olfr548-ps1 C A 7: 102,541,970 H11Q probably damaging Het
Olfr732 T G 14: 50,281,524 H243P probably damaging Het
Otud7b T C 3: 96,155,891 C816R probably damaging Het
Pi4k2a T C 19: 42,100,644 V148A probably benign Het
Pih1d2 T C 9: 50,621,179 M195T probably benign Het
Plpp6 T C 19: 28,964,778 F260L probably damaging Het
R3hcc1l A T 19: 42,581,954 T663S probably damaging Het
Rnf25 T C 1: 74,595,267 E199G probably damaging Het
Scin G A 12: 40,084,381 probably benign Het
Serpinb1c A T 13: 32,896,990 S37T probably benign Het
Snx19 A G 9: 30,428,343 D259G probably damaging Het
Sorcs3 A G 19: 48,764,181 K805R probably damaging Het
Sox6 C A 7: 115,777,123 G125W probably damaging Het
Spink5 A G 18: 43,967,107 I64V probably benign Het
St6galnac1 A G 11: 116,766,648 probably benign Het
Sult1c2 T C 17: 53,836,963 I105V probably benign Het
Tacr3 T G 3: 134,829,756 S162A probably damaging Het
Tex43 T A 18: 56,594,534 D101E probably benign Het
Ttc6 T C 12: 57,674,763 S1013P probably damaging Het
Zbtb11 C A 16: 55,990,815 N445K probably benign Het
Zfp59 T C 7: 27,853,591 V156A probably benign Het
Zscan2 C A 7: 80,863,393 A42E probably damaging Het
Other mutations in Zfp423
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Zfp423 APN 8 87781611 unclassified probably null
IGL01359:Zfp423 APN 8 87780662 missense probably damaging 1.00
IGL01780:Zfp423 APN 8 87781508 missense probably damaging 1.00
IGL02250:Zfp423 APN 8 87783255 missense probably damaging 1.00
IGL02301:Zfp423 APN 8 87781574 missense probably damaging 1.00
IGL02320:Zfp423 APN 8 87781602 missense probably damaging 1.00
IGL02804:Zfp423 APN 8 87782657 missense probably benign 0.02
IGL03090:Zfp423 APN 8 87781443 missense probably damaging 1.00
IGL03198:Zfp423 APN 8 87781676 missense possibly damaging 0.73
IGL03383:Zfp423 APN 8 87859452 nonsense probably null
swell UTSW 8 87686559 splice site probably null
R0110:Zfp423 UTSW 8 87782259 missense possibly damaging 0.60
R0142:Zfp423 UTSW 8 87780340 nonsense probably null
R0256:Zfp423 UTSW 8 87773634 nonsense probably null
R0538:Zfp423 UTSW 8 87782085 missense probably damaging 0.99
R0542:Zfp423 UTSW 8 87780609 missense probably damaging 1.00
R0614:Zfp423 UTSW 8 87782114 missense probably damaging 1.00
R1179:Zfp423 UTSW 8 87688072 missense probably damaging 0.97
R1417:Zfp423 UTSW 8 87773656 splice site probably null
R1429:Zfp423 UTSW 8 87686442 missense probably damaging 0.99
R2013:Zfp423 UTSW 8 87782397 missense probably benign 0.43
R2043:Zfp423 UTSW 8 87782618 missense probably damaging 1.00
R2064:Zfp423 UTSW 8 87781358 missense probably benign 0.04
R2108:Zfp423 UTSW 8 87781178 missense possibly damaging 0.73
R2358:Zfp423 UTSW 8 87780551 missense possibly damaging 0.56
R3177:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3277:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3738:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3739:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3773:Zfp423 UTSW 8 87780512 missense probably benign 0.03
R4034:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R4425:Zfp423 UTSW 8 87782973 missense probably damaging 1.00
R4611:Zfp423 UTSW 8 87688081 missense possibly damaging 0.90
R4700:Zfp423 UTSW 8 87781710 unclassified probably null
R4753:Zfp423 UTSW 8 87781446 missense probably benign 0.00
R4818:Zfp423 UTSW 8 87904500 missense probably benign 0.00
R5026:Zfp423 UTSW 8 87780674 missense probably damaging 1.00
R5190:Zfp423 UTSW 8 87782463 missense probably damaging 1.00
R5243:Zfp423 UTSW 8 87773647 missense probably benign 0.03
R5284:Zfp423 UTSW 8 87781677 missense possibly damaging 0.73
R5586:Zfp423 UTSW 8 87859340 missense possibly damaging 0.93
R5601:Zfp423 UTSW 8 87782009 missense probably damaging 1.00
R5671:Zfp423 UTSW 8 87782327 missense probably damaging 0.99
R5717:Zfp423 UTSW 8 87686559 splice site probably null
R5801:Zfp423 UTSW 8 87859362 missense probably damaging 0.99
R5917:Zfp423 UTSW 8 87782232 nonsense probably null
R5985:Zfp423 UTSW 8 87782146 missense possibly damaging 0.83
R6111:Zfp423 UTSW 8 87782687 missense probably damaging 0.99
R6306:Zfp423 UTSW 8 87782034 missense possibly damaging 0.64
R6770:Zfp423 UTSW 8 87781817 missense probably damaging 0.99
R6970:Zfp423 UTSW 8 87803779 missense probably benign 0.00
R7029:Zfp423 UTSW 8 87688066 missense probably damaging 0.99
R7060:Zfp423 UTSW 8 87782879 missense probably damaging 1.00
R7074:Zfp423 UTSW 8 87782432 missense probably benign 0.00
R7121:Zfp423 UTSW 8 87780861 missense probably damaging 1.00
R7242:Zfp423 UTSW 8 87904527 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGATGAATCTCTAGCACAGCCAGG -3'
(R):5'- AGCTCTCAGAGAAGGCGGATCTAC -3'

Sequencing Primer
(F):5'- GCTGGTAAAGTCCCGCTTAG -3'
(R):5'- AGGCGGATCTACAGTGCATC -3'
Posted On2014-04-24