Incidental Mutation 'R1583:Adgrb3'
ID177226
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R1583 (G1)
Quality Score108
Status Validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 25226831 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably null
Transcript: ENSMUST00000041838
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126096
Predicted Effect probably null
Transcript: ENSMUST00000126626
SMART Domains Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
Pfam:7tm_2 4 273 7.3e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134022
Predicted Effect probably null
Transcript: ENSMUST00000135518
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146592
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151309
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153568
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTCCTTGGACCAGGCTCACAC -3'
(R):5'- GTGATGGGCTGTAACCAAGCATTTG -3'

Sequencing Primer
(F):5'- TTCTGAGGTTCAACAGCAGC -3'
(R):5'- GCTGTAACCAAGCATTTGAAACTC -3'
Posted On2014-04-24