Incidental Mutation 'R1583:Mga'
ID177234
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene NameMAX gene associated
SynonymsD030062C11Rik, Mga, Mad5, C130042M01Rik
MMRRC Submission 039620-MU
Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119897228-119969581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119963960 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 2590 (H2590Q)
Ref Sequence ENSEMBL: ENSMUSP00000106400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
Predicted Effect probably benign
Transcript: ENSMUST00000046717
AA Change: H2669Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: H2669Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079934
AA Change: H2499Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: H2499Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110773
AA Change: H2590Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: H2590Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110774
AA Change: H2708Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: H2708Q

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131396
Predicted Effect probably benign
Transcript: ENSMUST00000156510
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Meta Mutation Damage Score 0.0436 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119919814 missense possibly damaging 0.65
IGL00719:Mga APN 2 119947453 nonsense probably null
IGL01619:Mga APN 2 119931828 missense possibly damaging 0.46
IGL01721:Mga APN 2 119935239 missense probably damaging 1.00
IGL01759:Mga APN 2 119951195 missense possibly damaging 0.92
IGL01785:Mga APN 2 119902912 missense probably damaging 1.00
IGL01786:Mga APN 2 119902912 missense probably damaging 1.00
IGL01950:Mga APN 2 119941654 missense possibly damaging 0.60
IGL01960:Mga APN 2 119938657 missense probably damaging 1.00
IGL02086:Mga APN 2 119924036 missense probably damaging 0.99
IGL02364:Mga APN 2 119964054 missense possibly damaging 0.66
IGL02602:Mga APN 2 119931884 missense possibly damaging 0.66
IGL02751:Mga APN 2 119947770 missense possibly damaging 0.82
IGL02794:Mga APN 2 119946289 missense possibly damaging 0.84
IGL03247:Mga APN 2 119935513 missense possibly damaging 0.81
IGL03303:Mga APN 2 119903452 missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119916504 missense probably damaging 1.00
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0417:Mga UTSW 2 119902790 missense probably damaging 0.99
R0449:Mga UTSW 2 119941381 missense probably damaging 1.00
R0457:Mga UTSW 2 119916488 missense probably damaging 0.98
R0538:Mga UTSW 2 119919706 critical splice donor site probably null
R0568:Mga UTSW 2 119935422 missense probably damaging 1.00
R0614:Mga UTSW 2 119964466 missense probably damaging 1.00
R0671:Mga UTSW 2 119919910 splice site probably null
R0811:Mga UTSW 2 119947961 missense probably damaging 0.99
R0812:Mga UTSW 2 119947961 missense probably damaging 0.99
R0948:Mga UTSW 2 119941659 missense possibly damaging 0.77
R1177:Mga UTSW 2 119926446 missense probably damaging 1.00
R1445:Mga UTSW 2 119902698 missense probably damaging 1.00
R1476:Mga UTSW 2 119941675 missense probably damaging 0.96
R1527:Mga UTSW 2 119916597 missense probably damaging 1.00
R1592:Mga UTSW 2 119964666 missense possibly damaging 0.93
R1627:Mga UTSW 2 119964562 missense probably damaging 1.00
R1658:Mga UTSW 2 119941689 missense possibly damaging 0.63
R1677:Mga UTSW 2 119960852 missense possibly damaging 0.92
R1887:Mga UTSW 2 119923617 missense probably damaging 1.00
R1908:Mga UTSW 2 119926594 missense possibly damaging 0.66
R1909:Mga UTSW 2 119926594 missense possibly damaging 0.66
R2061:Mga UTSW 2 119964980 unclassified probably benign
R2145:Mga UTSW 2 119964157 missense possibly damaging 0.85
R2159:Mga UTSW 2 119919643 missense probably damaging 0.96
R2179:Mga UTSW 2 119960442 missense probably damaging 0.99
R2281:Mga UTSW 2 119903723 missense probably benign
R2423:Mga UTSW 2 119964793 missense probably damaging 1.00
R3620:Mga UTSW 2 119916668 missense probably damaging 1.00
R3622:Mga UTSW 2 119941764 missense probably damaging 1.00
R3624:Mga UTSW 2 119941764 missense probably damaging 1.00
R3802:Mga UTSW 2 119947339 missense probably damaging 0.96
R4011:Mga UTSW 2 119931780 missense probably damaging 1.00
R4065:Mga UTSW 2 119947002 missense probably damaging 1.00
R4520:Mga UTSW 2 119948098 missense possibly damaging 0.85
R4649:Mga UTSW 2 119941493 missense possibly damaging 0.81
R4660:Mga UTSW 2 119938623 intron probably benign
R4757:Mga UTSW 2 119903639 missense possibly damaging 0.82
R4771:Mga UTSW 2 119964294 missense probably damaging 1.00
R4784:Mga UTSW 2 119903057 missense probably damaging 1.00
R4866:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4900:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4952:Mga UTSW 2 119903301 missense probably damaging 1.00
R4995:Mga UTSW 2 119932582 nonsense probably null
R5020:Mga UTSW 2 119951173 nonsense probably null
R5082:Mga UTSW 2 119903344 missense probably damaging 0.98
R5208:Mga UTSW 2 119947981 missense possibly damaging 0.83
R5454:Mga UTSW 2 119903329 missense probably damaging 0.99
R5466:Mga UTSW 2 119902697 missense probably damaging 1.00
R5484:Mga UTSW 2 119916626 missense possibly damaging 0.58
R5669:Mga UTSW 2 119903426 missense probably damaging 1.00
R5819:Mga UTSW 2 119941263 missense possibly damaging 0.61
R5916:Mga UTSW 2 119964312 missense probably benign 0.27
R5942:Mga UTSW 2 119946959 missense probably benign 0.41
R6305:Mga UTSW 2 119947698 missense probably benign 0.00
R6434:Mga UTSW 2 119923938 missense probably damaging 0.99
R6467:Mga UTSW 2 119946295 missense probably damaging 1.00
R6488:Mga UTSW 2 119960907 missense probably damaging 1.00
R6630:Mga UTSW 2 119923659 missense probably damaging 0.99
R6790:Mga UTSW 2 119923754 missense probably damaging 0.99
R7029:Mga UTSW 2 119923550 missense probably damaging 1.00
R7039:Mga UTSW 2 119932678 missense probably benign 0.28
R7088:Mga UTSW 2 119961936 missense probably damaging 1.00
R7195:Mga UTSW 2 119917328 missense probably damaging 1.00
R7273:Mga UTSW 2 119935214 missense probably damaging 1.00
R7286:Mga UTSW 2 119964788 missense possibly damaging 0.93
R7346:Mga UTSW 2 119935527 missense possibly damaging 0.56
R7383:Mga UTSW 2 119960340 missense probably damaging 0.99
R7469:Mga UTSW 2 119903046 missense probably damaging 1.00
R7484:Mga UTSW 2 119946229 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATGGCAAGCCACTTGACCAC -3'
(R):5'- GTTAGTCAGCAGCTCACTGGGATG -3'

Sequencing Primer
(F):5'- TTGACCACCTGAGAGACATTG -3'
(R):5'- GATAGCCGAGGCTACTTTCC -3'
Posted On2014-04-24