Incidental Mutation 'R1583:Fbxo10'
ID177238
Institutional Source Beutler Lab
Gene Symbol Fbxo10
Ensembl Gene ENSMUSG00000048232
Gene NameF-box protein 10
SynonymsFBX10, LOC269529
MMRRC Submission 039620-MU
Accession Numbers

Genbank: NM_001024142; MGI: 2686937  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1583 (G1)
Quality Score166
Status Validated
Chromosome4
Chromosomal Location45034247-45084604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45062118 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 136 (L136R)
Ref Sequence ENSEMBL: ENSMUSP00000058233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052236]
Predicted Effect probably damaging
Transcript: ENSMUST00000052236
AA Change: L136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058233
Gene: ENSMUSG00000048232
AA Change: L136R

DomainStartEndE-ValueType
FBOX 6 48 1.92e-6 SMART
PbH1 198 217 8.34e3 SMART
PbH1 238 260 1.37e3 SMART
CASH 337 511 7.29e-6 SMART
PbH1 423 444 1.41e2 SMART
PbH1 467 489 1.33e3 SMART
PbH1 490 512 1.32e2 SMART
PbH1 513 535 8.34e3 SMART
PbH1 536 558 2.87e1 SMART
CASH 536 672 5.49e1 SMART
PbH1 559 581 1.25e1 SMART
PbH1 582 604 2.64e2 SMART
PbH1 605 627 6.05e3 SMART
PbH1 628 650 2.46e2 SMART
PbH1 651 673 2.14e2 SMART
CASH 681 804 6.58e1 SMART
PbH1 713 735 6.52e2 SMART
PbH1 736 758 5.92e2 SMART
PbH1 760 782 1.13e3 SMART
PbH1 783 805 1.86e2 SMART
PbH1 828 850 9.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140008
SMART Domains Protein: ENSMUSP00000119862
Gene: ENSMUSG00000048232

DomainStartEndE-ValueType
PbH1 25 44 8.34e3 SMART
PbH1 65 87 1.37e3 SMART
CASH 164 338 7.29e-6 SMART
PbH1 250 271 1.41e2 SMART
PbH1 294 316 1.33e3 SMART
PbH1 317 339 1.32e2 SMART
PbH1 340 362 8.34e3 SMART
PbH1 363 385 2.87e1 SMART
CASH 363 499 5.49e1 SMART
PbH1 386 408 1.25e1 SMART
PbH1 409 431 2.64e2 SMART
PbH1 432 454 6.05e3 SMART
PbH1 455 477 2.46e2 SMART
PbH1 478 500 2.14e2 SMART
CASH 508 631 6.58e1 SMART
PbH1 540 562 6.52e2 SMART
PbH1 563 585 5.92e2 SMART
PbH1 587 609 1.13e3 SMART
PbH1 610 632 1.86e2 SMART
PbH1 655 677 9.32e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155583
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Fbxo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Fbxo10 APN 4 45058684 missense probably damaging 0.98
IGL02073:Fbxo10 APN 4 45046349 missense possibly damaging 0.94
IGL02097:Fbxo10 APN 4 45048527 missense probably benign 0.24
IGL02315:Fbxo10 APN 4 45062469 missense probably benign 0.08
IGL02403:Fbxo10 APN 4 45062517 missense probably benign 0.01
IGL02408:Fbxo10 APN 4 45058361 missense possibly damaging 0.75
IGL02496:Fbxo10 APN 4 45043883 missense probably damaging 1.00
IGL02583:Fbxo10 APN 4 45044754 missense probably damaging 1.00
IGL02794:Fbxo10 APN 4 45041928 missense probably benign 0.20
N/A - 287:Fbxo10 UTSW 4 45044708 splice site probably benign
R1033:Fbxo10 UTSW 4 45062236 missense probably damaging 1.00
R1102:Fbxo10 UTSW 4 45043672 missense probably damaging 1.00
R1586:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R1789:Fbxo10 UTSW 4 45046389 missense probably damaging 1.00
R2187:Fbxo10 UTSW 4 45058531 missense probably benign 0.09
R2191:Fbxo10 UTSW 4 45044811 missense probably damaging 1.00
R2377:Fbxo10 UTSW 4 45044719 missense probably benign 0.18
R2425:Fbxo10 UTSW 4 45051642 missense possibly damaging 0.60
R2495:Fbxo10 UTSW 4 45040545 missense probably benign 0.00
R4105:Fbxo10 UTSW 4 45059054 missense probably benign 0.01
R4472:Fbxo10 UTSW 4 45043693 missense probably damaging 1.00
R4480:Fbxo10 UTSW 4 45048470 missense probably damaging 1.00
R4985:Fbxo10 UTSW 4 45040692 missense probably benign 0.33
R5193:Fbxo10 UTSW 4 45051573 nonsense probably null
R5309:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5312:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5348:Fbxo10 UTSW 4 45058934 missense probably damaging 1.00
R5694:Fbxo10 UTSW 4 45035970 missense probably damaging 1.00
R5844:Fbxo10 UTSW 4 45058760 missense probably benign 0.09
R5974:Fbxo10 UTSW 4 45040631 missense probably benign 0.18
R5990:Fbxo10 UTSW 4 45061960 missense probably damaging 1.00
R6197:Fbxo10 UTSW 4 45043857 missense probably benign 0.03
R6359:Fbxo10 UTSW 4 45041796 missense possibly damaging 0.93
R6808:Fbxo10 UTSW 4 45059035 missense probably benign 0.00
R6873:Fbxo10 UTSW 4 45041787 missense possibly damaging 0.94
R6921:Fbxo10 UTSW 4 45044849 missense probably damaging 1.00
R7089:Fbxo10 UTSW 4 45062230 missense possibly damaging 0.90
R7120:Fbxo10 UTSW 4 45040533 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCATGAAGACAAGATTGCACACAC -3'
(R):5'- TATGAGCTGATCCTCAGCCTGGAC -3'

Sequencing Primer
(F):5'- ACGTGTGGTTGAGCAGTG -3'
(R):5'- CAACCAGCCTGATGTGGAG -3'
Posted On2014-04-24