Incidental Mutation 'R1583:Fbxo30'
ID177261
Institutional Source Beutler Lab
Gene Symbol Fbxo30
Ensembl Gene ENSMUSG00000047648
Gene NameF-box protein 30
SynonymsFbx30
MMRRC Submission 039620-MU
Accession Numbers

Ncbi RefSeq: NM_027968.3, NM_001168297.1; MGI: 1919115

Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location11281330-11298052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11291374 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 613 (H613Q)
Ref Sequence ENSEMBL: ENSMUSP00000117687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070300] [ENSMUST00000129456]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070300
AA Change: H613Q

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068230
Gene: ENSMUSG00000047648
AA Change: H613Q

DomainStartEndE-ValueType
Pfam:zf-TRAF_2 8 100 2.5e-42 PFAM
Pfam:F-box_4 610 725 1.6e-52 PFAM
Pfam:F-box 612 653 3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129456
AA Change: H613Q

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117687
Gene: ENSMUSG00000047648
AA Change: H613Q

DomainStartEndE-ValueType
PDB:2YRE|A 1 88 6e-51 PDB
SCOP:d1k2fa_ 58 93 7e-3 SMART
Pfam:F-box 612 653 2.3e-7 PFAM
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it is upregulated in nasopharyngeal carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Fbxo30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Fbxo30 APN 10 11290539 missense probably benign 0.01
IGL00971:Fbxo30 APN 10 11290298 missense probably benign
IGL02388:Fbxo30 APN 10 11290378 missense probably benign 0.01
PIT4468001:Fbxo30 UTSW 10 11290956 missense possibly damaging 0.95
R0014:Fbxo30 UTSW 10 11289859 nonsense probably null
R0144:Fbxo30 UTSW 10 11295220 missense probably damaging 1.00
R0709:Fbxo30 UTSW 10 11291313 missense possibly damaging 0.79
R1791:Fbxo30 UTSW 10 11289787 nonsense probably null
R2018:Fbxo30 UTSW 10 11291028 missense probably damaging 0.98
R2317:Fbxo30 UTSW 10 11290334 missense probably damaging 0.98
R3842:Fbxo30 UTSW 10 11290112 missense probably damaging 0.98
R4579:Fbxo30 UTSW 10 11289549 missense probably benign 0.00
R4655:Fbxo30 UTSW 10 11291093 missense probably damaging 1.00
R4751:Fbxo30 UTSW 10 11290195 missense probably benign 0.01
R4998:Fbxo30 UTSW 10 11290763 missense probably damaging 0.98
R5325:Fbxo30 UTSW 10 11291102 missense possibly damaging 0.89
R5463:Fbxo30 UTSW 10 11291069 missense probably damaging 1.00
R5534:Fbxo30 UTSW 10 11289665 missense possibly damaging 0.91
R5594:Fbxo30 UTSW 10 11290479 missense probably benign 0.13
R5757:Fbxo30 UTSW 10 11290421 missense probably benign 0.08
R5917:Fbxo30 UTSW 10 11289518 critical splice acceptor site probably null
R6232:Fbxo30 UTSW 10 11289858 missense possibly damaging 0.90
R6472:Fbxo30 UTSW 10 11291231 missense probably damaging 1.00
R6677:Fbxo30 UTSW 10 11290636 missense possibly damaging 0.61
R6802:Fbxo30 UTSW 10 11291480 missense probably damaging 1.00
R7128:Fbxo30 UTSW 10 11290116 nonsense probably null
X0012:Fbxo30 UTSW 10 11290466 missense probably benign 0.00
X0066:Fbxo30 UTSW 10 11290812 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGACTCAATGGATGGATGGAAC -3'
(R):5'- AGCACGAGTAAGTGACTACTTGATGC -3'

Sequencing Primer
(F):5'- ATGGAACAGAGGTGTCCTTTAGC -3'
(R):5'- GTAAGTGACTACTTGATGCTAAGAG -3'
Posted On2014-04-24