Incidental Mutation 'R1583:Mylk'
ID177284
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Namemyosin, light polypeptide kinase
SynonymsMlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1583 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location34745210-35002420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34875586 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 230 (D230E)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: D230E

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: D230E

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155268
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Scrn1 A T 6: 54,520,769 V279E probably damaging Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
brutus UTSW 16 34953695 missense probably benign 0.12
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 utr 5 prime probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACTCAAGCCCTGGTGTCCATTC -3'
(R):5'- CAGGCAGCTCATAGCATCTTCCTC -3'

Sequencing Primer
(F):5'- CTTGTAGGGAAATGTCCCGT -3'
(R):5'- GTTGAAAACTTTGTCCTTCACATGC -3'
Posted On2014-04-24