Incidental Mutation 'R1584:Ash1l'
ID 177315
Institutional Source Beutler Lab
Gene Symbol Ash1l
Ensembl Gene ENSMUSG00000028053
Gene Name ASH1 like histone lysine methyltransferase
Synonyms E430018P19Rik, 8030453L17Rik, KMT2H, chromatin remodeling factor
MMRRC Submission 039621-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1584 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 88857929-88986682 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88959372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 2250 (Y2250H)
Ref Sequence ENSEMBL: ENSMUSP00000140251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000090933
AA Change: Y2250H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: Y2250H

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104616
Predicted Effect probably damaging
Transcript: ENSMUST00000186583
AA Change: Y2250H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: Y2250H

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189824
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Ager A G 17: 34,819,692 (GRCm39) E357G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
Btrc T A 19: 45,501,821 (GRCm39) probably benign Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cdc123 T A 2: 5,808,788 (GRCm39) probably null Het
Cilp G A 9: 65,186,997 (GRCm39) G1031S probably damaging Het
Cldn5 G A 16: 18,596,227 (GRCm39) G161D probably damaging Het
Cndp2 G A 18: 84,695,440 (GRCm39) probably benign Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dop1a A T 9: 86,430,225 (GRCm39) R2200* probably null Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Dysf A G 6: 84,044,029 (GRCm39) K259R probably benign Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Epha2 T A 4: 141,049,358 (GRCm39) probably null Het
Fam20b T C 1: 156,513,758 (GRCm39) probably benign Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Fhad1 T C 4: 141,712,822 (GRCm39) I206V probably benign Het
Figla A G 6: 85,997,764 (GRCm39) E164G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Hecw1 A G 13: 14,515,328 (GRCm39) probably null Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T C 8: 111,307,447 (GRCm39) V3942A probably benign Het
Irs1 G T 1: 82,267,165 (GRCm39) H350Q probably benign Het
Kdm1b G A 13: 47,217,530 (GRCm39) E46K probably damaging Het
Klf11 A G 12: 24,705,304 (GRCm39) N253D probably damaging Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Lilra6 T A 7: 3,915,661 (GRCm39) D358V probably damaging Het
Mmrn2 A G 14: 34,097,642 (GRCm39) D24G probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Nfu1 G A 6: 86,997,791 (GRCm39) E225K probably damaging Het
Nin A T 12: 70,089,443 (GRCm39) L1324Q probably benign Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5b116 T C 19: 13,423,023 (GRCm39) Y216H probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Or8c9 G A 9: 38,241,427 (GRCm39) M181I possibly damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pals1 A G 12: 78,876,501 (GRCm39) I482V probably benign Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Pm20d2 A T 4: 33,174,772 (GRCm39) N371K probably damaging Het
Ppp2r5d A G 17: 46,995,610 (GRCm39) Y480H probably benign Het
Prkd1 A T 12: 50,472,298 (GRCm39) V205E probably damaging Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rel T A 11: 23,695,546 (GRCm39) T246S probably damaging Het
Rnf215 T A 11: 4,086,719 (GRCm39) V172E probably damaging Het
Scara3 T C 14: 66,158,553 (GRCm39) D485G probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Tapbp C T 17: 34,138,914 (GRCm39) probably null Het
Tep1 A T 14: 51,103,494 (GRCm39) N265K probably damaging Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tln2 T A 9: 67,203,696 (GRCm39) N470I probably damaging Het
Trim43a G T 9: 88,470,211 (GRCm39) W339L probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Ttc8 A G 12: 98,887,023 (GRCm39) E32G probably benign Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vamp8 G A 6: 72,362,617 (GRCm39) T35M probably damaging Het
Vill A G 9: 118,894,654 (GRCm39) Y53C probably damaging Het
Vmn1r222 A T 13: 23,416,932 (GRCm39) S94T probably damaging Het
Vmn2r93 A G 17: 18,525,413 (GRCm39) Y357C possibly damaging Het
Vps13c T A 9: 67,800,394 (GRCm39) V536D possibly damaging Het
Vrtn G A 12: 84,696,855 (GRCm39) C535Y probably damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Ykt6 T A 11: 5,912,349 (GRCm39) F101I probably damaging Het
Zfp277 C T 12: 40,428,825 (GRCm39) G174D probably benign Het
Zfp638 A G 6: 83,955,047 (GRCm39) probably null Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Ash1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ash1l APN 3 88,889,019 (GRCm39) missense probably benign 0.19
IGL00819:Ash1l APN 3 88,915,043 (GRCm39) missense possibly damaging 0.68
IGL00939:Ash1l APN 3 88,942,543 (GRCm39) missense probably damaging 0.99
IGL01064:Ash1l APN 3 88,979,791 (GRCm39) missense probably damaging 1.00
IGL01066:Ash1l APN 3 88,891,942 (GRCm39) missense probably damaging 1.00
IGL01087:Ash1l APN 3 88,971,209 (GRCm39) missense probably damaging 1.00
IGL01293:Ash1l APN 3 88,890,836 (GRCm39) missense probably benign 0.01
IGL01541:Ash1l APN 3 88,973,572 (GRCm39) missense probably damaging 1.00
IGL01863:Ash1l APN 3 88,892,813 (GRCm39) nonsense probably null
IGL02326:Ash1l APN 3 88,873,364 (GRCm39) missense probably benign 0.00
IGL02407:Ash1l APN 3 88,979,855 (GRCm39) missense probably damaging 1.00
IGL02419:Ash1l APN 3 88,892,872 (GRCm39) missense probably benign 0.00
IGL02422:Ash1l APN 3 88,976,386 (GRCm39) critical splice donor site probably null
IGL02494:Ash1l APN 3 88,973,525 (GRCm39) nonsense probably null
IGL02727:Ash1l APN 3 88,930,344 (GRCm39) missense probably benign
IGL02732:Ash1l APN 3 88,873,535 (GRCm39) missense probably damaging 1.00
IGL02817:Ash1l APN 3 88,892,108 (GRCm39) missense probably damaging 1.00
IGL02887:Ash1l APN 3 88,891,488 (GRCm39) missense probably benign 0.11
IGL03224:Ash1l APN 3 88,942,575 (GRCm39) splice site probably benign
IGL03253:Ash1l APN 3 88,891,981 (GRCm39) missense probably damaging 1.00
IGL03327:Ash1l APN 3 88,930,390 (GRCm39) missense probably benign 0.02
IGL03398:Ash1l APN 3 88,914,527 (GRCm39) missense probably benign 0.01
3-1:Ash1l UTSW 3 88,873,633 (GRCm39) missense probably benign
BB008:Ash1l UTSW 3 88,950,848 (GRCm39) missense probably damaging 1.00
BB018:Ash1l UTSW 3 88,950,848 (GRCm39) missense probably damaging 1.00
R0068:Ash1l UTSW 3 88,914,624 (GRCm39) missense probably benign 0.17
R0068:Ash1l UTSW 3 88,914,624 (GRCm39) missense probably benign 0.17
R0239:Ash1l UTSW 3 88,974,529 (GRCm39) missense possibly damaging 0.49
R0239:Ash1l UTSW 3 88,974,529 (GRCm39) missense possibly damaging 0.49
R0395:Ash1l UTSW 3 88,965,896 (GRCm39) missense probably damaging 1.00
R0477:Ash1l UTSW 3 88,890,766 (GRCm39) missense probably benign 0.41
R0528:Ash1l UTSW 3 88,889,584 (GRCm39) missense probably benign
R0543:Ash1l UTSW 3 88,971,085 (GRCm39) splice site probably null
R0855:Ash1l UTSW 3 88,961,761 (GRCm39) missense possibly damaging 0.82
R1147:Ash1l UTSW 3 88,892,194 (GRCm39) missense possibly damaging 0.72
R1147:Ash1l UTSW 3 88,892,194 (GRCm39) missense possibly damaging 0.72
R1163:Ash1l UTSW 3 88,942,570 (GRCm39) critical splice donor site probably null
R1196:Ash1l UTSW 3 88,890,623 (GRCm39) missense probably damaging 0.99
R1419:Ash1l UTSW 3 88,892,204 (GRCm39) missense probably damaging 0.99
R1445:Ash1l UTSW 3 88,914,659 (GRCm39) missense probably benign 0.02
R1466:Ash1l UTSW 3 88,959,372 (GRCm39) missense probably damaging 1.00
R1466:Ash1l UTSW 3 88,959,372 (GRCm39) missense probably damaging 1.00
R1480:Ash1l UTSW 3 88,892,359 (GRCm39) missense probably damaging 1.00
R1506:Ash1l UTSW 3 88,965,806 (GRCm39) missense probably damaging 0.99
R1537:Ash1l UTSW 3 88,979,783 (GRCm39) missense probably damaging 0.99
R1669:Ash1l UTSW 3 88,974,549 (GRCm39) critical splice donor site probably null
R1713:Ash1l UTSW 3 88,983,531 (GRCm39) missense probably damaging 1.00
R1780:Ash1l UTSW 3 88,873,291 (GRCm39) missense probably benign
R1793:Ash1l UTSW 3 88,977,616 (GRCm39) missense probably damaging 1.00
R1881:Ash1l UTSW 3 88,888,862 (GRCm39) missense probably benign 0.00
R1909:Ash1l UTSW 3 88,891,835 (GRCm39) missense probably benign 0.29
R1938:Ash1l UTSW 3 88,891,729 (GRCm39) missense probably damaging 0.98
R2035:Ash1l UTSW 3 88,973,624 (GRCm39) missense probably benign 0.00
R2070:Ash1l UTSW 3 88,873,510 (GRCm39) missense probably damaging 1.00
R2071:Ash1l UTSW 3 88,873,510 (GRCm39) missense probably damaging 1.00
R2114:Ash1l UTSW 3 88,890,571 (GRCm39) missense probably benign 0.00
R2116:Ash1l UTSW 3 88,890,571 (GRCm39) missense probably benign 0.00
R2118:Ash1l UTSW 3 88,892,602 (GRCm39) missense possibly damaging 0.80
R2143:Ash1l UTSW 3 88,892,726 (GRCm39) missense probably benign 0.09
R2164:Ash1l UTSW 3 88,892,726 (GRCm39) missense probably benign 0.09
R2210:Ash1l UTSW 3 88,973,605 (GRCm39) missense probably damaging 1.00
R2247:Ash1l UTSW 3 88,914,674 (GRCm39) missense possibly damaging 0.77
R2303:Ash1l UTSW 3 88,933,733 (GRCm39) missense probably damaging 1.00
R2860:Ash1l UTSW 3 88,961,785 (GRCm39) missense probably damaging 1.00
R2861:Ash1l UTSW 3 88,961,785 (GRCm39) missense probably damaging 1.00
R3104:Ash1l UTSW 3 88,961,693 (GRCm39) missense probably damaging 1.00
R4133:Ash1l UTSW 3 88,889,567 (GRCm39) missense probably benign 0.00
R4164:Ash1l UTSW 3 88,889,273 (GRCm39) missense probably damaging 0.97
R4270:Ash1l UTSW 3 88,889,347 (GRCm39) missense probably benign 0.26
R4271:Ash1l UTSW 3 88,889,347 (GRCm39) missense probably benign 0.26
R4287:Ash1l UTSW 3 88,973,722 (GRCm39) missense probably damaging 0.99
R4409:Ash1l UTSW 3 88,914,506 (GRCm39) missense probably damaging 0.99
R4459:Ash1l UTSW 3 88,873,541 (GRCm39) missense probably damaging 0.99
R4487:Ash1l UTSW 3 88,892,622 (GRCm39) missense possibly damaging 0.65
R4674:Ash1l UTSW 3 88,979,783 (GRCm39) missense possibly damaging 0.80
R4739:Ash1l UTSW 3 88,890,152 (GRCm39) missense probably benign 0.19
R4927:Ash1l UTSW 3 88,892,641 (GRCm39) missense probably damaging 1.00
R5000:Ash1l UTSW 3 88,965,941 (GRCm39) missense probably damaging 1.00
R5016:Ash1l UTSW 3 88,889,630 (GRCm39) missense probably damaging 1.00
R5055:Ash1l UTSW 3 88,930,519 (GRCm39) critical splice donor site probably null
R5081:Ash1l UTSW 3 88,892,024 (GRCm39) missense probably damaging 1.00
R5082:Ash1l UTSW 3 88,873,541 (GRCm39) missense probably damaging 0.99
R5090:Ash1l UTSW 3 88,960,184 (GRCm39) missense probably damaging 1.00
R5113:Ash1l UTSW 3 88,973,582 (GRCm39) missense probably damaging 0.99
R5408:Ash1l UTSW 3 88,889,701 (GRCm39) missense probably damaging 1.00
R5452:Ash1l UTSW 3 88,892,183 (GRCm39) missense possibly damaging 0.93
R5487:Ash1l UTSW 3 88,888,733 (GRCm39) missense probably benign 0.17
R5610:Ash1l UTSW 3 88,930,492 (GRCm39) missense probably damaging 1.00
R5624:Ash1l UTSW 3 88,892,916 (GRCm39) missense probably damaging 1.00
R5682:Ash1l UTSW 3 88,914,914 (GRCm39) missense probably damaging 0.99
R5712:Ash1l UTSW 3 88,959,297 (GRCm39) missense probably damaging 0.99
R5719:Ash1l UTSW 3 88,965,933 (GRCm39) missense probably damaging 1.00
R5719:Ash1l UTSW 3 88,961,805 (GRCm39) missense possibly damaging 0.83
R5839:Ash1l UTSW 3 88,890,658 (GRCm39) missense probably damaging 0.99
R5859:Ash1l UTSW 3 88,976,300 (GRCm39) missense probably damaging 1.00
R5877:Ash1l UTSW 3 88,888,891 (GRCm39) missense probably benign 0.00
R5940:Ash1l UTSW 3 88,891,343 (GRCm39) missense probably damaging 0.96
R6026:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6027:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6029:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6033:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6033:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6034:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6034:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6035:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6035:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6089:Ash1l UTSW 3 88,960,450 (GRCm39) nonsense probably null
R6110:Ash1l UTSW 3 88,892,436 (GRCm39) missense probably damaging 1.00
R6168:Ash1l UTSW 3 88,960,080 (GRCm39) nonsense probably null
R6200:Ash1l UTSW 3 88,977,834 (GRCm39) missense probably damaging 1.00
R6290:Ash1l UTSW 3 88,890,068 (GRCm39) nonsense probably null
R6331:Ash1l UTSW 3 88,915,172 (GRCm39) missense probably benign 0.00
R6425:Ash1l UTSW 3 88,891,087 (GRCm39) missense probably damaging 0.99
R6540:Ash1l UTSW 3 88,892,368 (GRCm39) missense probably damaging 1.00
R6568:Ash1l UTSW 3 88,959,344 (GRCm39) missense probably benign 0.09
R6828:Ash1l UTSW 3 88,983,420 (GRCm39) missense probably benign 0.00
R6843:Ash1l UTSW 3 88,892,695 (GRCm39) missense probably damaging 1.00
R6894:Ash1l UTSW 3 88,890,298 (GRCm39) missense probably benign 0.00
R6976:Ash1l UTSW 3 88,888,964 (GRCm39) missense possibly damaging 0.77
R7038:Ash1l UTSW 3 88,889,978 (GRCm39) missense probably benign 0.00
R7073:Ash1l UTSW 3 88,892,647 (GRCm39) missense probably damaging 1.00
R7133:Ash1l UTSW 3 88,890,764 (GRCm39) frame shift probably null
R7150:Ash1l UTSW 3 88,984,381 (GRCm39) missense probably damaging 1.00
R7205:Ash1l UTSW 3 88,873,259 (GRCm39) missense probably benign 0.00
R7254:Ash1l UTSW 3 88,977,816 (GRCm39) missense probably damaging 1.00
R7272:Ash1l UTSW 3 88,961,941 (GRCm39) splice site probably null
R7288:Ash1l UTSW 3 88,873,199 (GRCm39) start gained probably benign
R7319:Ash1l UTSW 3 88,888,694 (GRCm39) missense probably benign 0.19
R7341:Ash1l UTSW 3 88,889,066 (GRCm39) missense possibly damaging 0.93
R7342:Ash1l UTSW 3 88,873,304 (GRCm39) missense possibly damaging 0.94
R7454:Ash1l UTSW 3 88,891,172 (GRCm39) missense probably benign 0.16
R7677:Ash1l UTSW 3 88,950,500 (GRCm39) missense probably damaging 1.00
R7822:Ash1l UTSW 3 88,914,571 (GRCm39) missense probably benign
R7857:Ash1l UTSW 3 88,891,616 (GRCm39) nonsense probably null
R7889:Ash1l UTSW 3 88,873,345 (GRCm39) missense probably benign 0.00
R7898:Ash1l UTSW 3 88,890,932 (GRCm39) missense possibly damaging 0.54
R7931:Ash1l UTSW 3 88,950,848 (GRCm39) missense probably damaging 1.00
R7937:Ash1l UTSW 3 88,977,624 (GRCm39) nonsense probably null
R7973:Ash1l UTSW 3 88,960,164 (GRCm39) missense probably benign
R8119:Ash1l UTSW 3 88,942,734 (GRCm39) missense probably damaging 1.00
R8157:Ash1l UTSW 3 88,971,014 (GRCm39) critical splice donor site probably null
R8162:Ash1l UTSW 3 88,977,553 (GRCm39) missense probably damaging 0.99
R8194:Ash1l UTSW 3 88,960,062 (GRCm39) missense probably damaging 1.00
R8306:Ash1l UTSW 3 88,873,259 (GRCm39) missense probably benign 0.00
R8497:Ash1l UTSW 3 88,914,951 (GRCm39) missense probably benign 0.02
R8558:Ash1l UTSW 3 88,891,713 (GRCm39) missense probably damaging 0.96
R8744:Ash1l UTSW 3 88,965,890 (GRCm39) missense possibly damaging 0.89
R8923:Ash1l UTSW 3 88,892,974 (GRCm39) missense possibly damaging 0.51
R8969:Ash1l UTSW 3 88,873,598 (GRCm39) missense possibly damaging 0.52
R8970:Ash1l UTSW 3 88,976,307 (GRCm39) missense probably benign 0.00
R9002:Ash1l UTSW 3 88,888,715 (GRCm39) missense probably benign 0.17
R9023:Ash1l UTSW 3 88,892,576 (GRCm39) missense probably damaging 1.00
R9032:Ash1l UTSW 3 88,891,529 (GRCm39) missense probably benign 0.00
R9032:Ash1l UTSW 3 88,889,294 (GRCm39) missense probably benign 0.19
R9049:Ash1l UTSW 3 88,914,671 (GRCm39) missense probably benign
R9085:Ash1l UTSW 3 88,891,529 (GRCm39) missense probably benign 0.00
R9085:Ash1l UTSW 3 88,889,294 (GRCm39) missense probably benign 0.19
R9130:Ash1l UTSW 3 88,965,848 (GRCm39) nonsense probably null
R9149:Ash1l UTSW 3 88,914,530 (GRCm39) missense probably benign
R9294:Ash1l UTSW 3 88,890,297 (GRCm39) missense possibly damaging 0.90
R9365:Ash1l UTSW 3 88,889,207 (GRCm39) missense possibly damaging 0.63
R9450:Ash1l UTSW 3 88,915,139 (GRCm39) missense possibly damaging 0.86
R9542:Ash1l UTSW 3 88,950,566 (GRCm39) missense probably damaging 1.00
R9558:Ash1l UTSW 3 88,889,521 (GRCm39) missense probably benign 0.02
R9572:Ash1l UTSW 3 88,960,188 (GRCm39) missense probably damaging 1.00
R9688:Ash1l UTSW 3 88,892,024 (GRCm39) missense probably damaging 1.00
R9736:Ash1l UTSW 3 88,891,733 (GRCm39) missense probably damaging 1.00
R9765:Ash1l UTSW 3 88,930,500 (GRCm39) missense probably damaging 1.00
R9789:Ash1l UTSW 3 88,873,373 (GRCm39) missense probably benign
X0017:Ash1l UTSW 3 88,891,892 (GRCm39) missense probably benign 0.45
X0019:Ash1l UTSW 3 88,977,863 (GRCm39) missense probably damaging 1.00
X0021:Ash1l UTSW 3 88,890,511 (GRCm39) missense probably benign 0.10
Z1088:Ash1l UTSW 3 88,890,016 (GRCm39) missense probably benign 0.00
Z1176:Ash1l UTSW 3 88,950,524 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGGCTGTTTACCTATCATGCTATG -3'
(R):5'- GCAAGACCCTCTCTCGAAAACTGAA -3'

Sequencing Primer
(F):5'- CCTATCATGCTATGATAAGACACCTG -3'
(R):5'- ctctcgaaaaCTGAAACCAAAAAATG -3'
Posted On 2014-04-24