Incidental Mutation 'R1584:Lars'
ID177395
Institutional Source Beutler Lab
Gene Symbol Lars
Ensembl Gene ENSMUSG00000024493
Gene Nameleucyl-tRNA synthetase
Synonyms2310045K21Rik, 3110009L02Rik
MMRRC Submission 039621-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1584 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42202350-42262122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42210050 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1101 (R1101C)
Ref Sequence ENSEMBL: ENSMUSP00000095197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097590]
Predicted Effect probably damaging
Transcript: ENSMUST00000097590
AA Change: R1101C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095197
Gene: ENSMUSG00000024493
AA Change: R1101C

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 19 112 5.8e-12 PFAM
Pfam:tRNA-synt_1g 48 114 3.5e-7 PFAM
low complexity region 141 157 N/A INTRINSIC
Pfam:tRNA-synt_1 173 758 3.6e-26 PFAM
Pfam:tRNA-synt_1g 632 764 1e-9 PFAM
Pfam:tRNA-synt_1e 660 761 2.8e-7 PFAM
Pfam:Anticodon_1 796 930 3e-18 PFAM
Blast:IL1 950 1086 4e-37 BLAST
Meta Mutation Damage Score 0.574 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic leucine-tRNA synthetase, a member of the class I aminoacyl-tRNA synthetase family. The encoded enzyme catalyzes the ATP-dependent ligation of L-leucine to tRNA(Leu). It is found in the cytoplasm as part of a multisynthetase complex and interacts with the arginine tRNA synthetase through its C-terminal domain. A mutation in this gene was found in affected individuals with infantile liver failure syndrome 1. Alternatively spliced transcript variants of this gene have been observed. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Ager A G 17: 34,600,718 E357G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cdc123 T A 2: 5,803,977 probably null Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Cldn5 G A 16: 18,777,477 G161D probably damaging Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dopey1 A T 9: 86,548,172 R2200* probably null Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Dysf A G 6: 84,067,047 K259R probably benign Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Epha2 T A 4: 141,322,047 probably null Het
Fam20b T C 1: 156,686,188 probably benign Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Fhad1 T C 4: 141,985,511 I206V probably benign Het
Figla A G 6: 86,020,782 E164G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Hecw1 A G 13: 14,340,743 probably null Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T C 8: 110,580,815 V3942A probably benign Het
Irs1 G T 1: 82,289,444 H350Q probably benign Het
Kdm1b G A 13: 47,064,054 E46K probably damaging Het
Klf11 A G 12: 24,655,305 N253D probably damaging Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lilra6 T A 7: 3,912,662 D358V probably damaging Het
Mmrn2 A G 14: 34,375,685 D24G probably benign Het
Mpp5 A G 12: 78,829,727 I482V probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Naga T A 15: 82,334,788 M237L probably null Het
Nfu1 G A 6: 87,020,809 E225K probably damaging Het
Nin A T 12: 70,042,669 L1324Q probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr1471 T C 19: 13,445,659 Y216H probably damaging Het
Olfr25 G A 9: 38,330,131 M181I possibly damaging Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Pm20d2 A T 4: 33,174,772 N371K probably damaging Het
Ppp2r5d A G 17: 46,684,684 Y480H probably benign Het
Prkd1 A T 12: 50,425,515 V205E probably damaging Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rel T A 11: 23,745,546 T246S probably damaging Het
Rnf215 T A 11: 4,136,719 V172E probably damaging Het
Scara3 T C 14: 65,921,104 D485G probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Tapbp C T 17: 33,919,940 probably null Het
Tep1 A T 14: 50,866,037 N265K probably damaging Het
Tln2 T A 9: 67,296,414 N470I probably damaging Het
Trim43a G T 9: 88,588,158 W339L probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Ttc8 A G 12: 98,920,764 E32G probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vamp8 G A 6: 72,385,634 T35M probably damaging Het
Vill A G 9: 119,065,586 Y53C probably damaging Het
Vmn1r222 A T 13: 23,232,762 S94T probably damaging Het
Vmn2r93 A G 17: 18,305,151 Y357C possibly damaging Het
Vps13c T A 9: 67,893,112 V536D possibly damaging Het
Vrtn G A 12: 84,650,081 C535Y probably damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Ykt6 T A 11: 5,962,349 F101I probably damaging Het
Zfp277 C T 12: 40,378,826 G174D probably benign Het
Zfp638 A G 6: 83,978,065 probably null Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Lars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lars APN 18 42229654 missense probably damaging 0.99
IGL01340:Lars APN 18 42202577 missense probably benign 0.01
IGL01397:Lars APN 18 42228029 missense probably damaging 1.00
IGL01510:Lars APN 18 42242109 missense probably benign
IGL01542:Lars APN 18 42214827 missense probably benign 0.09
IGL01689:Lars APN 18 42216949 missense probably benign
IGL01819:Lars APN 18 42202550 missense probably benign 0.00
IGL02142:Lars APN 18 42227280 missense probably benign 0.01
IGL02598:Lars APN 18 42227277 missense possibly damaging 0.61
IGL02630:Lars APN 18 42257169 missense probably damaging 0.97
IGL02973:Lars APN 18 42214759 critical splice donor site probably null
IGL03064:Lars APN 18 42221571 nonsense probably null
IGL03081:Lars APN 18 42210091 missense probably benign 0.00
IGL03330:Lars APN 18 42219944 missense probably benign
IGL03334:Lars APN 18 42221506 missense probably benign
IGL03340:Lars APN 18 42228650 splice site probably benign
R0165:Lars UTSW 18 42202697 missense possibly damaging 0.91
R0321:Lars UTSW 18 42202632 missense probably damaging 0.96
R0325:Lars UTSW 18 42250902 missense possibly damaging 0.88
R0391:Lars UTSW 18 42251363 missense probably benign 0.00
R0558:Lars UTSW 18 42214837 missense probably benign
R0624:Lars UTSW 18 42242784 splice site probably benign
R0881:Lars UTSW 18 42214786 missense probably benign 0.22
R0968:Lars UTSW 18 42218583 missense probably benign 0.09
R1457:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1583:Lars UTSW 18 42210050 missense probably damaging 1.00
R1851:Lars UTSW 18 42212608 missense probably benign 0.09
R1852:Lars UTSW 18 42212608 missense probably benign 0.09
R1868:Lars UTSW 18 42214837 missense probably benign 0.04
R1954:Lars UTSW 18 42210050 missense probably damaging 1.00
R2277:Lars UTSW 18 42235502 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3733:Lars UTSW 18 42212602 missense probably benign 0.00
R4208:Lars UTSW 18 42229703 missense probably benign 0.34
R4571:Lars UTSW 18 42228230 splice site probably null
R5009:Lars UTSW 18 42221547 missense probably benign 0.03
R5033:Lars UTSW 18 42214776 missense possibly damaging 0.92
R5152:Lars UTSW 18 42228777 missense possibly damaging 0.96
R5208:Lars UTSW 18 42217557 missense probably benign
R5219:Lars UTSW 18 42234720 missense probably benign 0.44
R5396:Lars UTSW 18 42216959 missense probably benign
R5433:Lars UTSW 18 42251298 missense possibly damaging 0.66
R5580:Lars UTSW 18 42214851 missense probably damaging 0.98
R5610:Lars UTSW 18 42257091 missense probably benign
R5784:Lars UTSW 18 42219899 missense probably benign 0.00
R6249:Lars UTSW 18 42257206 splice site probably null
R6334:Lars UTSW 18 42217486 missense probably benign
R6618:Lars UTSW 18 42244908 missense possibly damaging 0.86
R6900:Lars UTSW 18 42234610 missense probably benign
R6958:Lars UTSW 18 42236639 missense probably damaging 1.00
R7390:Lars UTSW 18 42210018 critical splice donor site probably null
R7451:Lars UTSW 18 42202550 missense probably benign 0.00
X0064:Lars UTSW 18 42228060 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGCGCTCAAGTGACACAGAAG -3'
(R):5'- AGTGTAGTCCATACACCAGGGCATC -3'

Sequencing Primer
(F):5'- CCCAAGGAAATCTATGTCTCCAGG -3'
(R):5'- AGGGCATCTTGGTGTAGACATAC -3'
Posted On2014-04-24