Incidental Mutation 'R1585:Gm14496'
ID177413
Institutional Source Beutler Lab
Gene Symbol Gm14496
Ensembl Gene ENSMUSG00000098505
Gene Namepredicted gene 14496
Synonyms
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181991226-182001766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181996209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 359 (S359P)
Ref Sequence ENSEMBL: ENSMUSP00000071670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071760]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071760
AA Change: S359P

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071670
Gene: ENSMUSG00000098505
AA Change: S359P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 456 1.3e-30 PFAM
Pfam:NCD3G 508 562 1.9e-18 PFAM
Pfam:7tm_3 595 830 7.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089788
SMART Domains Protein: ENSMUSP00000087221
Gene: ENSMUSG00000053277

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.8e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184507
Meta Mutation Damage Score 0.1096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Gm14496
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Gm14496 APN 2 181995021 missense probably damaging 1.00
IGL01300:Gm14496 APN 2 182000960 missense probably damaging 1.00
IGL01328:Gm14496 APN 2 181995880 missense probably damaging 1.00
IGL01526:Gm14496 APN 2 181995665 missense probably benign 0.12
IGL01576:Gm14496 APN 2 181991371 missense possibly damaging 0.92
IGL01775:Gm14496 APN 2 182000332 missense probably benign 0.00
IGL02020:Gm14496 APN 2 181996089 missense possibly damaging 0.95
IGL02150:Gm14496 APN 2 181991347 missense probably damaging 0.99
IGL02170:Gm14496 APN 2 181996351 missense probably damaging 1.00
IGL02262:Gm14496 APN 2 181996012 missense probably damaging 1.00
IGL02398:Gm14496 APN 2 181996170 missense probably benign 0.09
IGL02414:Gm14496 APN 2 181991405 missense probably benign 0.03
IGL02541:Gm14496 APN 2 182000393 missense probably benign 0.29
IGL02741:Gm14496 APN 2 181991343 missense probably benign
IGL02933:Gm14496 APN 2 182000463 missense probably benign 0.15
IGL03214:Gm14496 APN 2 182000536 missense probably damaging 1.00
FR4342:Gm14496 UTSW 2 181995906 missense probably benign 0.01
R0158:Gm14496 UTSW 2 181997413 missense probably benign 0.07
R0271:Gm14496 UTSW 2 181995954 missense probably benign 0.44
R0611:Gm14496 UTSW 2 181995111 missense probably benign 0.00
R0833:Gm14496 UTSW 2 181996266 missense probably damaging 0.99
R0834:Gm14496 UTSW 2 181995687 missense probably benign 0.00
R0906:Gm14496 UTSW 2 182000515 missense probably damaging 0.98
R1298:Gm14496 UTSW 2 181996092 missense probably benign 0.39
R1500:Gm14496 UTSW 2 181991233 missense probably benign 0.21
R1610:Gm14496 UTSW 2 181996179 missense probably benign 0.01
R1627:Gm14496 UTSW 2 181998778 missense probably damaging 1.00
R1635:Gm14496 UTSW 2 182001044 missense possibly damaging 0.88
R1663:Gm14496 UTSW 2 181997437 missense probably benign 0.03
R1792:Gm14496 UTSW 2 181996153 missense probably benign 0.00
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1922:Gm14496 UTSW 2 182001004 missense probably benign 0.22
R2081:Gm14496 UTSW 2 182000479 missense probably damaging 1.00
R2102:Gm14496 UTSW 2 181991334 missense possibly damaging 0.88
R2176:Gm14496 UTSW 2 181991337 missense probably benign
R4154:Gm14496 UTSW 2 181995079 missense probably benign 0.01
R4789:Gm14496 UTSW 2 181995784 missense possibly damaging 0.85
R4873:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R4875:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R5020:Gm14496 UTSW 2 181991359 missense possibly damaging 0.67
R5354:Gm14496 UTSW 2 182000809 missense probably damaging 1.00
R5361:Gm14496 UTSW 2 182000354 missense probably benign 0.07
R5457:Gm14496 UTSW 2 181997608 missense probably damaging 0.96
R5589:Gm14496 UTSW 2 181995881 nonsense probably null
R5655:Gm14496 UTSW 2 181996182 missense probably benign 0.06
R6007:Gm14496 UTSW 2 181997530 missense probably benign 0.37
R6123:Gm14496 UTSW 2 181991227 start codon destroyed probably null 1.00
R6159:Gm14496 UTSW 2 181996257 missense probably benign 0.01
R6168:Gm14496 UTSW 2 182000957 missense probably damaging 1.00
R6454:Gm14496 UTSW 2 181996222 missense probably damaging 0.97
R6502:Gm14496 UTSW 2 182000593 missense probably benign 0.01
R6649:Gm14496 UTSW 2 181997476 missense possibly damaging 0.83
X0058:Gm14496 UTSW 2 181995986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATAGGTTGCCCCATGTCCATCAG -3'
(R):5'- AGTGAAATCTCGTTTGGGATCTGCC -3'

Sequencing Primer
(F):5'- GACAACCAGGGTATTCAGTTTCTC -3'
(R):5'- GGGATCTGCCCTTTTCTGAGAC -3'
Posted On2014-04-24