Incidental Mutation 'R1585:Il11ra1'
ID177416
Institutional Source Beutler Lab
Gene Symbol Il11ra1
Ensembl Gene ENSMUSG00000073889
Gene Nameinterleukin 11 receptor, alpha chain 1
SynonymsIl11ra, Il-11ra, NR1, Il-11ra-alpha
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41699989-41769474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41768207 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 373 (S373T)
Ref Sequence ENSEMBL: ENSMUSP00000103677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074387] [ENSMUST00000098132] [ENSMUST00000108032] [ENSMUST00000108033] [ENSMUST00000108035] [ENSMUST00000108036] [ENSMUST00000108037] [ENSMUST00000108040] [ENSMUST00000108041] [ENSMUST00000108042] [ENSMUST00000131349] [ENSMUST00000151142] [ENSMUST00000155240] [ENSMUST00000155322] [ENSMUST00000173865]
Predicted Effect probably benign
Transcript: ENSMUST00000074387
SMART Domains Protein: ENSMUSP00000073990
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCY 31 97 5.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098132
AA Change: S373T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095736
Gene: ENSMUSG00000073889
AA Change: S373T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108032
Predicted Effect probably benign
Transcript: ENSMUST00000108033
SMART Domains Protein: ENSMUSP00000103668
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SCY 30 96 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108035
SMART Domains Protein: ENSMUSP00000103670
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 38 104 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108036
SMART Domains Protein: ENSMUSP00000103671
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108037
SMART Domains Protein: ENSMUSP00000103672
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108040
AA Change: S373T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103675
Gene: ENSMUSG00000073889
AA Change: S373T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108041
AA Change: S373T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889
AA Change: S373T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108042
AA Change: S373T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103677
Gene: ENSMUSG00000073889
AA Change: S373T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130197
Predicted Effect probably benign
Transcript: ENSMUST00000131349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146608
Predicted Effect probably benign
Transcript: ENSMUST00000151142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152748
Predicted Effect probably benign
Transcript: ENSMUST00000155240
Predicted Effect probably benign
Transcript: ENSMUST00000155322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155538
Predicted Effect probably benign
Transcript: ENSMUST00000173865
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
MGI Phenotype PHENOTYPE: Female homozygotes for targeted null mutations are infertile due to defective decidua formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Il11ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02681:Il11ra1 APN 4 41768552 missense possibly damaging 0.73
R0013:Il11ra1 UTSW 4 41765060 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0365:Il11ra1 UTSW 4 41767527 missense probably damaging 1.00
R0399:Il11ra1 UTSW 4 41766185 missense probably benign 0.03
R1591:Il11ra1 UTSW 4 41766200 missense probably damaging 1.00
R2424:Il11ra1 UTSW 4 41768222 missense probably damaging 1.00
R3037:Il11ra1 UTSW 4 41765074 missense possibly damaging 0.94
R4393:Il11ra1 UTSW 4 41768577 critical splice donor site probably null
R4770:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R4798:Il11ra1 UTSW 4 41766096 unclassified probably benign
R5256:Il11ra1 UTSW 4 41767932 unclassified probably benign
R6005:Il11ra1 UTSW 4 41763887 critical splice donor site probably null
R6309:Il11ra1 UTSW 4 41765279 missense possibly damaging 0.87
R6499:Il11ra1 UTSW 4 41765412 missense probably benign 0.04
R6833:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
R6834:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACCTGATTGGAGCCAGGGACAC -3'
(R):5'- TCAGCCTCAGCCTGAAGCATAAAAG -3'

Sequencing Primer
(F):5'- CAGCTAGAGGCAGTAGTAGCTC -3'
(R):5'- CGTCCACGAGGATTGATTAGC -3'
Posted On2014-04-24