Incidental Mutation 'R1585:St3gal3'
ID177419
Institutional Source Beutler Lab
Gene Symbol St3gal3
Ensembl Gene ENSMUSG00000028538
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 3
SynonymsSiat6, Siat3, ST3Gal III
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117932154-118134914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 117960007 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 44 (A44D)
Ref Sequence ENSEMBL: ENSMUSP00000121051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030263] [ENSMUST00000097912] [ENSMUST00000106410] [ENSMUST00000126336]
Predicted Effect probably benign
Transcript: ENSMUST00000030263
AA Change: A150D

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030263
Gene: ENSMUSG00000028538
AA Change: A150D

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 102 373 5.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097912
AA Change: A134D

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095525
Gene: ENSMUSG00000028538
AA Change: A134D

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 86 357 5.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106410
AA Change: A150D

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102018
Gene: ENSMUSG00000028538
AA Change: A150D

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 106 372 4.7e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126336
AA Change: A44D

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121051
Gene: ENSMUSG00000028538
AA Change: A44D

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 1 159 4.9e-44 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138274
AA Change: A95D
SMART Domains Protein: ENSMUSP00000114444
Gene: ENSMUSG00000028538
AA Change: A95D

DomainStartEndE-ValueType
Pfam:Glyco_transf_29 52 264 4.8e-38 PFAM
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with autosomal recessive nonsymdromic mental retardation-12 (MRT12). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene show an apparently normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in St3gal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:St3gal3 APN 4 118031875 missense probably damaging 1.00
IGL02004:St3gal3 APN 4 117960039 missense possibly damaging 0.90
IGL02339:St3gal3 APN 4 117958562 missense probably damaging 1.00
IGL03186:St3gal3 APN 4 117940054 missense possibly damaging 0.93
R0598:St3gal3 UTSW 4 118107632 missense probably benign 0.38
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1474:St3gal3 UTSW 4 118014786 missense probably damaging 1.00
R1584:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1696:St3gal3 UTSW 4 117940392 missense possibly damaging 0.52
R1735:St3gal3 UTSW 4 118014774 missense probably damaging 1.00
R1958:St3gal3 UTSW 4 117940071 missense probably damaging 0.96
R4008:St3gal3 UTSW 4 117940440 missense probably benign 0.34
R4700:St3gal3 UTSW 4 117960035 missense probably benign 0.01
R5434:St3gal3 UTSW 4 117940050 missense probably damaging 1.00
R6257:St3gal3 UTSW 4 118107678 start gained probably benign
R6854:St3gal3 UTSW 4 117958530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGGGTCTATTGCCTTCAGAGC -3'
(R):5'- GTCTAGCTGTGGTGCCTCAGAAAAC -3'

Sequencing Primer
(F):5'- AGACTTAAGCTCTGTTCCCTGTTAG -3'
(R):5'- AAGATACGTGCTGAGCCTG -3'
Posted On2014-04-24