Incidental Mutation 'R1585:Ncor2'
ID177425
Institutional Source Beutler Lab
Gene Symbol Ncor2
Ensembl Gene ENSMUSG00000029478
Gene Namenuclear receptor co-repressor 2
SynonymsSMRT, SMRTe
MMRRC Submission 039622-MU
Accession Numbers

Ncbi RefSeq: NM_011424.3, NM_001253904.1, NM_001253905.1; MGI:1337080

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1585 (G1)
Quality Score188
Status Validated
Chromosome5
Chromosomal Location125017153-125179219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125084998 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 404 (Q404R)
Ref Sequence ENSEMBL: ENSMUSP00000107033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055256] [ENSMUST00000086083] [ENSMUST00000111393] [ENSMUST00000111394] [ENSMUST00000111398] [ENSMUST00000111402]
Predicted Effect unknown
Transcript: ENSMUST00000055256
AA Change: Q404R
SMART Domains Protein: ENSMUSP00000055954
Gene: ENSMUSG00000029478
AA Change: Q404R

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1100 1116 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1481 1497 N/A INTRINSIC
low complexity region 1616 1622 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1737 1754 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1921 1939 N/A INTRINSIC
low complexity region 1959 1975 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
PDB:2GPV|I 2293 2314 8e-8 PDB
low complexity region 2324 2336 N/A INTRINSIC
low complexity region 2433 2453 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000086083
AA Change: Q404R
SMART Domains Protein: ENSMUSP00000083250
Gene: ENSMUSG00000029478
AA Change: Q404R

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1364 1378 N/A INTRINSIC
low complexity region 1479 1495 N/A INTRINSIC
low complexity region 1614 1620 N/A INTRINSIC
low complexity region 1707 1724 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
low complexity region 1762 1774 N/A INTRINSIC
low complexity region 1798 1805 N/A INTRINSIC
low complexity region 1916 1934 N/A INTRINSIC
low complexity region 1954 1970 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
PDB:2GPV|I 2288 2309 8e-8 PDB
low complexity region 2319 2331 N/A INTRINSIC
low complexity region 2428 2448 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111393
AA Change: Q229R
SMART Domains Protein: ENSMUSP00000107024
Gene: ENSMUSG00000029478
AA Change: Q229R

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
SANT 253 301 4.42e-6 SMART
coiled coil region 319 375 N/A INTRINSIC
SANT 432 480 1.43e-14 SMART
low complexity region 493 511 N/A INTRINSIC
low complexity region 524 551 N/A INTRINSIC
low complexity region 593 638 N/A INTRINSIC
low complexity region 647 653 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 692 699 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
low complexity region 760 769 N/A INTRINSIC
low complexity region 813 824 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
low complexity region 1475 1481 N/A INTRINSIC
low complexity region 1568 1585 N/A INTRINSIC
low complexity region 1596 1613 N/A INTRINSIC
low complexity region 1623 1635 N/A INTRINSIC
low complexity region 1659 1666 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
low complexity region 1921 1935 N/A INTRINSIC
PDB:2GPV|I 2152 2173 7e-8 PDB
low complexity region 2183 2195 N/A INTRINSIC
low complexity region 2292 2312 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111394
AA Change: Q185R
SMART Domains Protein: ENSMUSP00000107025
Gene: ENSMUSG00000029478
AA Change: Q185R

DomainStartEndE-ValueType
SANT 209 257 4.42e-6 SMART
coiled coil region 275 331 N/A INTRINSIC
SANT 388 436 1.43e-14 SMART
low complexity region 449 467 N/A INTRINSIC
low complexity region 480 507 N/A INTRINSIC
low complexity region 549 594 N/A INTRINSIC
low complexity region 603 609 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
low complexity region 648 655 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
low complexity region 866 876 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 1146 1160 N/A INTRINSIC
low complexity region 1261 1277 N/A INTRINSIC
low complexity region 1396 1402 N/A INTRINSIC
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1517 1534 N/A INTRINSIC
low complexity region 1544 1556 N/A INTRINSIC
low complexity region 1580 1587 N/A INTRINSIC
low complexity region 1701 1719 N/A INTRINSIC
low complexity region 1739 1755 N/A INTRINSIC
low complexity region 1842 1856 N/A INTRINSIC
PDB:2GPV|I 2073 2094 7e-8 PDB
low complexity region 2104 2116 N/A INTRINSIC
low complexity region 2213 2233 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111398
AA Change: Q404R
SMART Domains Protein: ENSMUSP00000107029
Gene: ENSMUSG00000029478
AA Change: Q404R

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1365 1379 N/A INTRINSIC
low complexity region 1480 1496 N/A INTRINSIC
low complexity region 1615 1621 N/A INTRINSIC
low complexity region 1708 1725 N/A INTRINSIC
low complexity region 1736 1753 N/A INTRINSIC
low complexity region 1763 1775 N/A INTRINSIC
low complexity region 1799 1806 N/A INTRINSIC
low complexity region 1920 1938 N/A INTRINSIC
low complexity region 1958 1974 N/A INTRINSIC
low complexity region 2061 2075 N/A INTRINSIC
PDB:2GPV|I 2292 2313 8e-8 PDB
low complexity region 2323 2335 N/A INTRINSIC
low complexity region 2432 2452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111402
AA Change: Q404R
SMART Domains Protein: ENSMUSP00000107033
Gene: ENSMUSG00000029478
AA Change: Q404R

DomainStartEndE-ValueType
Pfam:GPS2_interact 141 229 4.9e-41 PFAM
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1515 1531 N/A INTRINSIC
low complexity region 1650 1656 N/A INTRINSIC
low complexity region 1743 1760 N/A INTRINSIC
low complexity region 1771 1788 N/A INTRINSIC
low complexity region 1798 1810 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1955 1973 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2096 2110 N/A INTRINSIC
PDB:2GPV|I 2327 2348 8e-8 PDB
low complexity region 2358 2370 N/A INTRINSIC
low complexity region 2467 2487 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198978
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
MGI Phenotype Strain: 3765904; 4329504
Lethality: E1-E16
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor co-repressor that mediates transcriptional silencing of certain target genes. The encoded protein is a member of a family of thyroid hormone- and retinoic acid receptor-associated co-repressors. This protein acts as part of a multisubunit complex which includes histone deacetylases to modify chromatin structure that prevents basal transcriptional activity of target genes. Aberrant expression of this gene is associated with certain cancers. Alternate splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele die before E16.5 of heart defects and exhibit neural defects. [provided by MGI curators]
Allele List at MGI

All alleles(145) : Targeted(2) Gene trapped(143)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Ncor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Ncor2 APN 5 125042743 critical splice donor site probably null
IGL00519:Ncor2 APN 5 125084924 missense unknown
IGL00900:Ncor2 APN 5 125025784 missense probably damaging 1.00
IGL00950:Ncor2 APN 5 125086890 missense unknown
IGL01320:Ncor2 APN 5 125109927 missense probably benign 0.00
IGL01382:Ncor2 APN 5 125055773 missense probably damaging 0.96
IGL01573:Ncor2 APN 5 125085026 missense unknown
IGL01721:Ncor2 APN 5 125050937 missense probably damaging 1.00
IGL01875:Ncor2 APN 5 125065870 missense unknown
IGL02090:Ncor2 APN 5 125034403 missense probably damaging 0.99
IGL02192:Ncor2 APN 5 125024237 missense probably damaging 1.00
IGL02396:Ncor2 APN 5 125037914 missense probably damaging 1.00
IGL02934:Ncor2 APN 5 125025557 missense probably benign 0.33
IGL02997:Ncor2 APN 5 125119570 intron probably benign
R0019:Ncor2 UTSW 5 125119481 critical splice donor site probably null
R0331:Ncor2 UTSW 5 125084917 missense unknown
R0333:Ncor2 UTSW 5 125034344 splice site probably benign
R0403:Ncor2 UTSW 5 125033337 missense possibly damaging 0.73
R0557:Ncor2 UTSW 5 125106305 nonsense probably null
R0562:Ncor2 UTSW 5 125085029 missense unknown
R0671:Ncor2 UTSW 5 125049387 missense probably benign 0.13
R0699:Ncor2 UTSW 5 125029112 unclassified probably benign
R0865:Ncor2 UTSW 5 125038982 missense probably benign 0.17
R1183:Ncor2 UTSW 5 125023521 missense possibly damaging 0.65
R1325:Ncor2 UTSW 5 125118780 intron probably benign
R1344:Ncor2 UTSW 5 125025446 missense probably damaging 1.00
R1433:Ncor2 UTSW 5 125109975 intron probably benign
R1481:Ncor2 UTSW 5 125027138 nonsense probably null
R1539:Ncor2 UTSW 5 125109939 missense probably benign 0.07
R1558:Ncor2 UTSW 5 125033546 missense probably damaging 1.00
R1611:Ncor2 UTSW 5 125110020 intron probably benign
R1764:Ncor2 UTSW 5 125028615 missense possibly damaging 0.91
R1789:Ncor2 UTSW 5 125019890 missense probably damaging 1.00
R1809:Ncor2 UTSW 5 125118793 intron probably benign
R1901:Ncor2 UTSW 5 125025425 missense probably benign 0.39
R1946:Ncor2 UTSW 5 125034412 missense probably damaging 1.00
R1970:Ncor2 UTSW 5 125038918 missense probably damaging 0.99
R2048:Ncor2 UTSW 5 125084932 missense unknown
R2137:Ncor2 UTSW 5 125030712 missense probably damaging 1.00
R2270:Ncor2 UTSW 5 125037955 missense probably benign 0.33
R2380:Ncor2 UTSW 5 125036080 missense possibly damaging 0.89
R2570:Ncor2 UTSW 5 125028800 critical splice acceptor site probably null
R2918:Ncor2 UTSW 5 125025760 missense probably damaging 0.99
R2921:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2922:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2923:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R3116:Ncor2 UTSW 5 125024166 missense probably damaging 1.00
R3768:Ncor2 UTSW 5 125028687 missense probably damaging 1.00
R3826:Ncor2 UTSW 5 125118692 intron probably benign
R3829:Ncor2 UTSW 5 125118692 intron probably benign
R3830:Ncor2 UTSW 5 125118692 intron probably benign
R3951:Ncor2 UTSW 5 125032256 missense possibly damaging 0.94
R4175:Ncor2 UTSW 5 125050956 missense probably damaging 0.99
R4360:Ncor2 UTSW 5 125028972 missense probably damaging 1.00
R4470:Ncor2 UTSW 5 125102641 critical splice donor site probably null
R4490:Ncor2 UTSW 5 125036815 splice site probably null
R4573:Ncor2 UTSW 5 125055825 missense probably damaging 0.99
R4611:Ncor2 UTSW 5 125030859 missense probably damaging 1.00
R4799:Ncor2 UTSW 5 125037060 critical splice donor site probably null
R4851:Ncor2 UTSW 5 125033367 missense possibly damaging 0.93
R4853:Ncor2 UTSW 5 125025105 missense probably damaging 0.99
R4853:Ncor2 UTSW 5 125081183 missense unknown
R4896:Ncor2 UTSW 5 125049340 critical splice donor site probably null
R4997:Ncor2 UTSW 5 125034010 missense probably damaging 0.99
R5057:Ncor2 UTSW 5 125048066 missense possibly damaging 0.86
R5253:Ncor2 UTSW 5 125026930 missense probably benign 0.44
R5461:Ncor2 UTSW 5 125027113 missense probably damaging 1.00
R5585:Ncor2 UTSW 5 125067911 nonsense probably null
R5638:Ncor2 UTSW 5 125048300 missense probably benign 0.33
R5879:Ncor2 UTSW 5 125026775 unclassified probably benign
R5967:Ncor2 UTSW 5 125068984 missense unknown
R5999:Ncor2 UTSW 5 125033441 missense probably damaging 1.00
R6020:Ncor2 UTSW 5 125020011 missense probably benign 0.14
R6109:Ncor2 UTSW 5 125055846 missense probably damaging 1.00
R6423:Ncor2 UTSW 5 125087902 missense unknown
R6462:Ncor2 UTSW 5 125024172 missense probably damaging 1.00
R6478:Ncor2 UTSW 5 125110005 intron probably benign
Z1088:Ncor2 UTSW 5 125067788 missense unknown
Z1088:Ncor2 UTSW 5 125086840 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGAGCTGTCTGGCTGAATGAATG -3'
(R):5'- AGGTCCTCTGCATACCTTGTGCTG -3'

Sequencing Primer
(F):5'- GGGACAAGGAGATCCATCTATTACC -3'
(R):5'- TTAAGCCAGACAGACATGTGC -3'
Posted On2014-04-24