Mutagenetix > Incidental Mutations

Incidental Mutation 'R1585:Bcam'

177432

Institutional Source

Beutler Lab

Gene Symbol

Bcam

Ensembl Gene

ENSMUSG00000002980

Gene Name

basal cell adhesion molecule

Synonyms

1200005K12Rik, Lu, B-CAM

MMRRC Submission

039622-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1585 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19756131-19771016 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19760186 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 393 (D393E)

Ref Sequence

ENSEMBL: ENSMUSP00000003061 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003061]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003061
AA Change: D393E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000003061
Gene: ENSMUSG00000002980
AA Change: D393E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG	32	137	3.1e-9	SMART
IG_like	174	254	1.89e1	SMART
IGc2	275	337	2.58e-6	SMART
IGc2	369	425	2.16e-8	SMART
IG_like	458	523	7.29e-2	SMART
transmembrane domain	541	563	N/A	INTRINSIC
low complexity region	601	619	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133271

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135632

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208280

Meta Mutation Damage Score

0.0196

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 91.2%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a null allele exhibit glomeruli abnormalities and increased thickness and disorganization of intestinal smooth muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	G	A	8: 45,956,478	S268L	probably benign	Het
2310057J18Rik	T	A	10: 28,982,522	I50F	possibly damaging	Het
4930505A04Rik	T	C	11: 30,427,175		probably benign	Het
Aadat	A	T	8: 60,526,680	D192V	possibly damaging	Het
Akap12	A	G	10: 4,353,640	D150G	probably benign	Het
Amigo3	A	T	9: 108,054,032	N218I	probably damaging	Het
Ankmy1	A	G	1: 92,899,651	S60P	probably benign	Het
Apol7e	G	A	15: 77,717,829	S209N	probably damaging	Het
AW551984	A	T	9: 39,599,336	Y234*	probably null	Het
Card9	A	G	2: 26,354,386	L444P	probably benign	Het
Ccar1	T	C	10: 62,751,001	E886G	unknown	Het
Ccnb2	A	T	9: 70,410,277		probably null	Het
Cd276	T	C	9: 58,535,555	S206G	probably damaging	Het
Cds1	T	A	5: 101,817,962		probably benign	Het
Chuk	T	C	19: 44,077,373	S661G	possibly damaging	Het
Col17a1	T	C	19: 47,650,837	N1090D	probably benign	Het
Col3a1	A	T	1: 45,327,866		probably null	Het
Crispld1	G	T	1: 17,750,800	V355F	possibly damaging	Het
Cspg4	A	T	9: 56,898,867	R2321W	probably damaging	Het
Dner	T	C	1: 84,585,456	T61A	probably benign	Het
Dnmt3a	A	T	12: 3,901,660	Y679F	probably damaging	Het
Dzip3	A	T	16: 48,977,878		probably benign	Het
Eif3l	T	C	15: 79,084,181	S217P	possibly damaging	Het
Fbxo42	T	A	4: 141,198,106		probably benign	Het
Fhod1	A	T	8: 105,337,325		probably benign	Het
Fzd1	T	A	5: 4,756,278	I435F	probably damaging	Het
Gapvd1	C	T	2: 34,712,195	V647I	possibly damaging	Het
Gm14496	T	C	2: 181,996,209	S359P	possibly damaging	Het
Gm5218	C	A	15: 81,499,540		noncoding transcript	Het
Hnrnph3	A	G	10: 63,015,800		probably null	Het
Hsd17b12	G	T	2: 94,033,976	T262K	probably damaging	Het
Igsf10	G	C	3: 59,330,417	P781R	probably damaging	Het
Il11ra1	T	A	4: 41,768,207	S373T	probably damaging	Het
Kdm3b	A	G	18: 34,809,292	D612G	probably damaging	Het
Ldb1	T	C	19: 46,034,464	T261A	probably damaging	Het
Lep	C	A	6: 29,069,090	H47N	possibly damaging	Het
Lrrtm2	A	T	18: 35,213,375	S291R	possibly damaging	Het
Ncor2	T	C	5: 125,084,998	Q404R	unknown	Het
Nlrp4d	T	C	7: 10,382,510	H148R	probably benign	Het
Nlrp9a	T	A	7: 26,558,668	D570E	probably benign	Het
Nphp3	G	A	9: 104,009,214	V202I	probably damaging	Het
Nptn	T	A	9: 58,640,790	N159K	probably benign	Het
Olfr1241	T	A	2: 89,482,971	T55S	probably benign	Het
Olfr1245	A	T	2: 89,575,402	V108D	possibly damaging	Het
Olfr568	G	A	7: 102,877,773	V218I	probably benign	Het
Olfr628	A	T	7: 103,732,378	T151S	possibly damaging	Het
Olfr920	A	T	9: 38,756,420	H244L	probably damaging	Het
Pcolce	T	A	5: 137,610,507	R13*	probably null	Het
Pdgfra	A	G	5: 75,192,603	Y1018C	probably damaging	Het
Prima1	A	G	12: 103,235,595	S74P	probably damaging	Het
Prl7c1	A	G	13: 27,778,855	L55P	probably damaging	Het
Rasef	A	G	4: 73,740,337	V513A	probably damaging	Het
Rgs1	T	C	1: 144,245,489		probably null	Het
Rlf	T	C	4: 121,148,291	E1164G	probably benign	Het
Rnf213	A	T	11: 119,463,345	N4016I	probably damaging	Het
Sae1	C	T	7: 16,330,612		probably null	Het
Serping1	A	T	2: 84,771,504	D207E	probably benign	Het
Setd2	T	A	9: 110,551,396	D33E	unknown	Het
Simc1	T	C	13: 54,525,258	M473T	probably benign	Het
Slc30a6	T	A	17: 74,418,615		probably benign	Het
Slc4a5	T	C	6: 83,265,687	L346P	probably damaging	Het
Spef2	T	A	15: 9,596,574	Q1473L	probably damaging	Het
St3gal3	G	T	4: 117,960,007	A44D	possibly damaging	Het
Sv2b	G	T	7: 75,147,677	T323K	probably damaging	Het
Sycp2	T	A	2: 178,351,668	N1228I	possibly damaging	Het
Thbs2	T	A	17: 14,689,768	M190L	probably benign	Het
Tnrc6a	G	A	7: 123,176,875	V1190I	probably benign	Het
Utrn	A	T	10: 12,436,285	I673K	possibly damaging	Het
Vmn2r114	C	T	17: 23,291,701	V602M	probably damaging	Het
Wdr7	A	T	18: 63,924,918	I1273L	probably benign	Het
Zfp618	T	C	4: 63,132,938	L652P	probably damaging	Het
Zfp804a	G	A	2: 82,053,751		probably benign	Het

Other mutations in Bcam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01065:Bcam	APN	7	19756799	missense	probably benign	0.02
IGL01433:Bcam	APN	7	19760182	missense	possibly damaging	0.75
IGL01712:Bcam	APN	7	19758767	missense	probably damaging	0.99
IGL01943:Bcam	APN	7	19765498	missense	probably damaging	1.00
IGL01946:Bcam	APN	7	19760117	nonsense	probably null
IGL02281:Bcam	APN	7	19758691	missense	probably damaging	1.00
IGL02714:Bcam	APN	7	19758807	splice site	probably benign
IGL02837:Bcam	UTSW	7	19764186	missense	probably damaging	1.00
R0063:Bcam	UTSW	7	19766848	missense	probably benign	0.21
R0063:Bcam	UTSW	7	19766848	missense	probably benign	0.21
R1500:Bcam	UTSW	7	19758964	missense	possibly damaging	0.75
R1575:Bcam	UTSW	7	19760382	missense	possibly damaging	0.87
R1768:Bcam	UTSW	7	19765618	missense	probably null	1.00
R1813:Bcam	UTSW	7	19766715	missense	probably damaging	1.00
R1896:Bcam	UTSW	7	19766715	missense	probably damaging	1.00
R2016:Bcam	UTSW	7	19760349	missense	probably benign	0.38
R2117:Bcam	UTSW	7	19758427	missense	possibly damaging	0.71
R3713:Bcam	UTSW	7	19764193	missense	probably benign	0.12
R3917:Bcam	UTSW	7	19765450	missense	probably damaging	1.00
R4596:Bcam	UTSW	7	19764157	missense	probably damaging	0.97
R4866:Bcam	UTSW	7	19765472	missense	probably benign	0.00
R4874:Bcam	UTSW	7	19769322	intron	probably benign
R5054:Bcam	UTSW	7	19756860	intron	probably benign
R5062:Bcam	UTSW	7	19760101	missense	possibly damaging	0.62
R6783:Bcam	UTSW	7	19766881	missense	probably damaging	1.00
R6853:Bcam	UTSW	7	19760406	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCCAAACCTTGGACGATGAGCTG -3'
(R):5'- AGTGACCACGTTTTCCCCACTG -3'

Sequencing Primer
(F):5'- CGATGAGCTGGAAACTCTGTG -3'
(R):5'- TCGTATTCCTGAACAGCAGCAG -3'

Posted On

2014-04-24