Incidental Mutation 'R1585:Olfr568'
ID177435
Institutional Source Beutler Lab
Gene Symbol Olfr568
Ensembl Gene ENSMUSG00000073965
Gene Nameolfactory receptor 568
SynonymsMOR14-3, MOR14-11, GA_x6K02T2PBJ9-5588278-5589228
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102877122-102878063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102877773 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 218 (V218I)
Ref Sequence ENSEMBL: ENSMUSP00000095818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098216]
Predicted Effect probably benign
Transcript: ENSMUST00000098216
AA Change: V218I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000095818
Gene: ENSMUSG00000073965
AA Change: V218I

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.6e-113 PFAM
Pfam:7TM_GPCR_Srsx 34 306 1.8e-7 PFAM
Pfam:7tm_1 40 291 1e-20 PFAM
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Olfr568
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Olfr568 APN 7 102877233 missense probably benign 0.02
IGL02349:Olfr568 APN 7 102877909 missense probably benign 0.06
IGL02421:Olfr568 APN 7 102877759 missense probably damaging 1.00
IGL03179:Olfr568 APN 7 102878072 unclassified probably benign
FR4737:Olfr568 UTSW 7 102877233 small insertion probably benign
R0003:Olfr568 UTSW 7 102877861 missense probably benign 0.02
R0126:Olfr568 UTSW 7 102877140 missense probably benign 0.25
R1435:Olfr568 UTSW 7 102877767 missense probably damaging 1.00
R1660:Olfr568 UTSW 7 102877656 missense probably damaging 1.00
R1678:Olfr568 UTSW 7 102877663 missense probably damaging 1.00
R2010:Olfr568 UTSW 7 102877685 nonsense probably null
R4706:Olfr568 UTSW 7 102877433 missense probably damaging 1.00
R5490:Olfr568 UTSW 7 102877893 missense probably damaging 1.00
R5632:Olfr568 UTSW 7 102877797 missense probably benign 0.00
R6370:Olfr568 UTSW 7 102877170 missense probably benign 0.43
R6675:Olfr568 UTSW 7 102877273 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CGTCATGTTGCCAGTTGTGCTC -3'
(R):5'- AGAATAGCCTTTCGAATCTGCTTCGTC -3'

Sequencing Primer
(F):5'- CCAGTTGTGCTCTTTGTCAAG -3'
(R):5'- CACTGTAGATTATAGGGTTGAGCAC -3'
Posted On2014-04-24