Incidental Mutation 'R1585:Nptn'
ID177445
Institutional Source Beutler Lab
Gene Symbol Nptn
Ensembl Gene ENSMUSG00000032336
Gene Nameneuroplastin
SynonymsSdfr1
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58582240-58657955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58640790 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 159 (N159K)
Ref Sequence ENSEMBL: ENSMUSP00000109756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085651] [ENSMUST00000114121] [ENSMUST00000175945] [ENSMUST00000176250] [ENSMUST00000176557] [ENSMUST00000176916] [ENSMUST00000177064] [ENSMUST00000177292] [ENSMUST00000177380]
Predicted Effect probably benign
Transcript: ENSMUST00000085651
AA Change: N159K

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082793
Gene: ENSMUSG00000032336
AA Change: N159K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 1.1e-3 SMART
IGc2 133 206 9.3e-7 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114121
AA Change: N159K

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109756
Gene: ENSMUSG00000032336
AA Change: N159K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 2.56e-1 SMART
IGc2 133 206 2.34e-4 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175945
SMART Domains Protein: ENSMUSP00000135576
Gene: ENSMUSG00000032336

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176126
Predicted Effect probably benign
Transcript: ENSMUST00000176250
AA Change: N49K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135250
Gene: ENSMUSG00000032336
AA Change: N49K

DomainStartEndE-ValueType
IGc2 23 96 2.34e-4 SMART
transmembrane domain 111 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176557
AA Change: N159K

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135541
Gene: ENSMUSG00000032336
AA Change: N159K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 2.56e-1 SMART
IGc2 133 206 2.34e-4 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176896
AA Change: N157K
SMART Domains Protein: ENSMUSP00000134761
Gene: ENSMUSG00000032336
AA Change: N157K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IG 37 117 2.56e-1 SMART
IGc2 132 205 2.34e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176916
AA Change: N49K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134977
Gene: ENSMUSG00000032336
AA Change: N49K

DomainStartEndE-ValueType
IGc2 23 96 2.34e-4 SMART
transmembrane domain 111 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177064
AA Change: N71K

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135316
Gene: ENSMUSG00000032336
AA Change: N71K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 45 118 2.34e-4 SMART
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177292
AA Change: N275K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135199
Gene: ENSMUSG00000032336
AA Change: N275K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 43 123 4.09e-9 SMART
IG 154 234 2.56e-1 SMART
IGc2 249 322 2.34e-4 SMART
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177380
SMART Domains Protein: ENSMUSP00000135886
Gene: ENSMUSG00000032336

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 2.56e-1 SMART
Meta Mutation Damage Score 0.1304 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic spine morphology, decreased CNS synapse formation, abnormal CNS synaptic transmission and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Nptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Nptn APN 9 58643639 missense probably damaging 1.00
IGL02043:Nptn APN 9 58640729 missense possibly damaging 0.56
kinda_slow UTSW 9 58623752 missense probably damaging 1.00
R0212:Nptn UTSW 9 58627881 missense probably benign 0.03
R1673:Nptn UTSW 9 58623732 missense probably benign 0.12
R2484:Nptn UTSW 9 58643673 missense possibly damaging 0.85
R4151:Nptn UTSW 9 58643542 missense probably benign 0.14
R4389:Nptn UTSW 9 58643772 missense probably damaging 1.00
R4721:Nptn UTSW 9 58640776 missense probably damaging 1.00
R5166:Nptn UTSW 9 58618980 nonsense probably null
R5346:Nptn UTSW 9 58623787 nonsense probably null
R6494:Nptn UTSW 9 58623752 missense probably damaging 1.00
R6520:Nptn UTSW 9 58643734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGACTCTGAGCCAGTAGGTAAGAC -3'
(R):5'- GCTCTGTATTCAACTGTGAAAGCAAGC -3'

Sequencing Primer
(F):5'- CTGAGCCAGTAGGTAAGACCTTTG -3'
(R):5'- CTTGTACACAGTCAATGCTGG -3'
Posted On2014-04-24