Incidental Mutation 'R1585:Amigo3'
ID177450
Institutional Source Beutler Lab
Gene Symbol Amigo3
Ensembl Gene ENSMUSG00000032593
Gene Nameadhesion molecule with Ig like domain 3
SynonymsE430002N15Rik
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108053159-108055701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108054032 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 218 (N218I)
Ref Sequence ENSEMBL: ENSMUSP00000082137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000047947] [ENSMUST00000085060] [ENSMUST00000112295] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047947
SMART Domains Protein: ENSMUSP00000036898
Gene: ENSMUSG00000070284

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 234 8e-48 PFAM
Pfam:NTP_transf_3 3 202 6.6e-12 PFAM
Pfam:Hexapep 259 294 1.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085060
AA Change: N218I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593
AA Change: N218I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 33 65 2.55e-2 SMART
LRR 65 83 6.97e1 SMART
LRR_TYP 84 107 1.56e-2 SMART
LRR 109 131 2.84e1 SMART
LRR 132 155 7.05e-1 SMART
LRR 156 176 3.98e1 SMART
LRR 182 206 5.56e0 SMART
Blast:LRRCT 219 274 8e-23 BLAST
IG 285 372 1.59e-6 SMART
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112295
SMART Domains Protein: ENSMUSP00000107914
Gene: ENSMUSG00000070284

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 235 2.1e-51 PFAM
Pfam:NTP_transf_3 3 199 1.1e-11 PFAM
Pfam:Hexapep 259 294 9.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159526
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162123
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173683
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Amigo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Amigo3 APN 9 108053402 missense possibly damaging 0.93
R0047:Amigo3 UTSW 9 108054658 missense probably benign
R0047:Amigo3 UTSW 9 108054658 missense probably benign
R1079:Amigo3 UTSW 9 108053852 missense probably benign 0.00
R1907:Amigo3 UTSW 9 108053636 missense probably benign 0.10
R2899:Amigo3 UTSW 9 108054154 missense probably benign 0.42
R4770:Amigo3 UTSW 9 108053535 missense probably damaging 0.97
R5188:Amigo3 UTSW 9 108054683 missense probably damaging 0.99
R6137:Amigo3 UTSW 9 108053728 missense probably damaging 1.00
R6781:Amigo3 UTSW 9 108053963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCCTGATGCACTTGGACC -3'
(R):5'- CCACAGAGCAGTTCTTGAAGACCC -3'

Sequencing Primer
(F):5'- ATGCACTTGGACCTGGATGC -3'
(R):5'- TCTTGAAGACCCGGCTGTG -3'
Posted On2014-04-24