Incidental Mutation 'R1585:Utrn'
ID177453
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Nameutrophin
SynonymsG-utrophin, DRP, Dmdl
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location12382188-12869365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12436285 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 673 (I673K)
Ref Sequence ENSEMBL: ENSMUSP00000151592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000217994] [ENSMUST00000218635] [ENSMUST00000219003]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076817
AA Change: I3116K

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: I3116K

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217994
AA Change: I673K

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218635
AA Change: I3116K

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219003
AA Change: I642K

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0219:Utrn UTSW 10 12684451 missense probably damaging 1.00
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1445:Utrn UTSW 10 12678574 splice site probably benign
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1778:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1818:Utrn UTSW 10 12709964 critical splice donor site probably null
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4782:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6919:Utrn UTSW 10 12693470 nonsense probably null
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAACATGGTTGTTTTCAGCAAGTGG -3'
(R):5'- AGCAGATGCGCTCTTGGTTTCC -3'

Sequencing Primer
(F):5'- gcagccagaggcaggtag -3'
(R):5'- CTTGGTTTCCTAAGTGCAAAGC -3'
Posted On2014-04-24