Incidental Mutation 'R1585:Hnrnph3'
ID177457
Institutional Source Beutler Lab
Gene Symbol Hnrnph3
Ensembl Gene ENSMUSG00000020069
Gene Nameheterogeneous nuclear ribonucleoprotein H3
SynonymshnRNP 2H9, Hnrph3
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63014664-63024217 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 63015800 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020263] [ENSMUST00000118898] [ENSMUST00000119567] [ENSMUST00000119814] [ENSMUST00000140743] [ENSMUST00000143594]
Predicted Effect probably null
Transcript: ENSMUST00000020263
SMART Domains Protein: ENSMUSP00000020263
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 191 N/A INTRINSIC
RRM 196 266 7.96e-9 SMART
low complexity region 272 286 N/A INTRINSIC
low complexity region 294 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118898
SMART Domains Protein: ENSMUSP00000112424
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 176 N/A INTRINSIC
RRM 181 251 7.96e-9 SMART
low complexity region 257 271 N/A INTRINSIC
low complexity region 279 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119567
SMART Domains Protein: ENSMUSP00000113429
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 515 N/A INTRINSIC
FYVE 532 599 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119814
SMART Domains Protein: ENSMUSP00000113134
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140743
SMART Domains Protein: ENSMUSP00000118444
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141616
Predicted Effect probably benign
Transcript: ENSMUST00000143594
SMART Domains Protein: ENSMUSP00000115339
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143689
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It is localized in nuclear bodies of the nucleus. This protein is involved in the splicing process and it also participates in early heat shock-induced splicing arrest by transiently leaving the hnRNP complexes. Several alternatively spliced transcript variants have been noted for this gene, however, not all are fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Hnrnph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hnrnph3 APN 10 63018124 makesense probably null
IGL02112:Hnrnph3 APN 10 63016405 critical splice donor site probably null
IGL02116:Hnrnph3 APN 10 63016076 intron probably benign
IGL02193:Hnrnph3 APN 10 63017277 missense probably damaging 0.98
IGL02211:Hnrnph3 APN 10 63017342 unclassified probably benign
IGL02410:Hnrnph3 APN 10 63015724 intron probably benign
IGL02616:Hnrnph3 APN 10 63019485 missense possibly damaging 0.66
IGL03033:Hnrnph3 APN 10 63018179 missense probably benign 0.00
IGL03367:Hnrnph3 APN 10 63017229 missense probably damaging 1.00
R0450:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0450:Hnrnph3 UTSW 10 63019500 missense probably damaging 0.99
R0469:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0469:Hnrnph3 UTSW 10 63019500 missense probably damaging 0.99
R4285:Hnrnph3 UTSW 10 63016468 missense probably damaging 1.00
R4706:Hnrnph3 UTSW 10 63017280 missense probably damaging 1.00
R5606:Hnrnph3 UTSW 10 63019443 missense possibly damaging 0.94
R5873:Hnrnph3 UTSW 10 63019391 critical splice donor site probably null
R5952:Hnrnph3 UTSW 10 63015595 intron probably benign
R6059:Hnrnph3 UTSW 10 63018862 unclassified probably benign
R6644:Hnrnph3 UTSW 10 63018893 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTGTTGTCAGTACATCCCACG -3'
(R):5'- TGTAACACAGGATGGCCCAAAACTC -3'

Sequencing Primer
(F):5'- TCAGTACATCCCACGCCATC -3'
(R):5'- GATGCTTCAGCATATCCTTCCAAAC -3'
Posted On2014-04-24