Incidental Mutation 'R1585:Simc1'
ID177465
Institutional Source Beutler Lab
Gene Symbol Simc1
Ensembl Gene ENSMUSG00000043183
Gene NameSUMO-interacting motifs containing 1
Synonyms4732471D19Rik
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54503779-54551290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54525258 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 473 (M473T)
Ref Sequence ENSEMBL: ENSMUSP00000113676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118072] [ENSMUST00000121401] [ENSMUST00000138869] [ENSMUST00000159721]
Predicted Effect probably benign
Transcript: ENSMUST00000118072
SMART Domains Protein: ENSMUSP00000112376
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 167 179 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 425 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121401
AA Change: M473T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113676
Gene: ENSMUSG00000043183
AA Change: M473T

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
internal_repeat_1 268 491 3.21e-17 PROSPERO
internal_repeat_1 579 832 3.21e-17 PROSPERO
low complexity region 852 868 N/A INTRINSIC
low complexity region 1068 1080 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1326 1344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123852
Predicted Effect probably benign
Transcript: ENSMUST00000138869
SMART Domains Protein: ENSMUSP00000124474
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150011
Predicted Effect probably benign
Transcript: ENSMUST00000159721
SMART Domains Protein: ENSMUSP00000124921
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
Meta Mutation Damage Score 0.1236 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Eif3l T C 15: 79,084,181 S217P possibly damaging Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Simc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Simc1 APN 13 54525176 missense probably benign 0.27
IGL00813:Simc1 APN 13 54546986 missense probably damaging 0.98
IGL01326:Simc1 APN 13 54524660 missense probably benign 0.00
IGL01587:Simc1 APN 13 54539704 missense probably damaging 1.00
IGL02887:Simc1 APN 13 54525258 missense probably benign 0.04
IGL02977:Simc1 APN 13 54526307 missense probably benign 0.15
IGL03051:Simc1 APN 13 54526223 missense probably benign 0.15
IGL03065:Simc1 APN 13 54537212 missense probably damaging 1.00
IGL03244:Simc1 APN 13 54550629 missense probably benign 0.06
R0158:Simc1 UTSW 13 54524717 missense probably benign 0.00
R0218:Simc1 UTSW 13 54526604 missense probably damaging 1.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0362:Simc1 UTSW 13 54528467 missense probably damaging 1.00
R0464:Simc1 UTSW 13 54537100 nonsense probably null
R0556:Simc1 UTSW 13 54525347 missense probably benign 0.16
R0616:Simc1 UTSW 13 54547032 missense probably benign 0.03
R0686:Simc1 UTSW 13 54525190 missense probably benign 0.31
R0715:Simc1 UTSW 13 54525655 missense possibly damaging 0.49
R0761:Simc1 UTSW 13 54526574 missense probably damaging 1.00
R1335:Simc1 UTSW 13 54525265 intron probably benign
R1344:Simc1 UTSW 13 54550479 missense probably damaging 1.00
R1345:Simc1 UTSW 13 54525247 intron probably benign
R1633:Simc1 UTSW 13 54525231 missense probably benign 0.05
R1725:Simc1 UTSW 13 54526406 missense probably damaging 0.99
R1826:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1827:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1893:Simc1 UTSW 13 54539715 missense probably damaging 0.99
R2012:Simc1 UTSW 13 54503888 missense probably benign 0.05
R2088:Simc1 UTSW 13 54541534 missense probably damaging 1.00
R2901:Simc1 UTSW 13 54541518 unclassified probably null
R2974:Simc1 UTSW 13 54550461 missense probably damaging 1.00
R4238:Simc1 UTSW 13 54526260 nonsense probably null
R4870:Simc1 UTSW 13 54539763 missense probably null 0.73
R4959:Simc1 UTSW 13 54525318 missense possibly damaging 0.49
R5104:Simc1 UTSW 13 54526362 missense probably benign 0.15
R5217:Simc1 UTSW 13 54539896 unclassified probably benign
R5319:Simc1 UTSW 13 54524982 missense probably benign 0.00
R5635:Simc1 UTSW 13 54525404 missense probably benign 0.00
R5660:Simc1 UTSW 13 54547089 missense probably benign 0.01
R5900:Simc1 UTSW 13 54547024 missense probably damaging 1.00
R5963:Simc1 UTSW 13 54525819 missense possibly damaging 0.84
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6089:Simc1 UTSW 13 54528490 missense probably benign 0.30
R6271:Simc1 UTSW 13 54539724 missense probably damaging 1.00
R6322:Simc1 UTSW 13 54550569 missense probably damaging 1.00
R6364:Simc1 UTSW 13 54524600 nonsense probably null
R6434:Simc1 UTSW 13 54526664 missense probably benign 0.22
R6627:Simc1 UTSW 13 54547074 missense probably damaging 1.00
R6758:Simc1 UTSW 13 54525548 missense possibly damaging 0.57
X0023:Simc1 UTSW 13 54541531 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCACTGCAAGATGTGCCACC -3'
(R):5'- ACTGTGTCACACCTCCTGATGACTG -3'

Sequencing Primer
(F):5'- AAGATGTGCCACCATTGCTG -3'
(R):5'- GACTGCATTACACTTCTTAGTGACTG -3'
Posted On2014-04-24