Mutagenetix > Incidental Mutations

Incidental Mutation 'R1585:Spef2'

177466

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

039622-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R1585 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 9596574 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 1473 (Q1473L)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]

Predicted Effect

probably damaging
Transcript: ENSMUST00000159288
AA Change: Q1473L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: Q1473L

Domain	Start	End	E-Value	Type
Pfam:CH_2	5	102	3.1e-25	PFAM
low complexity region	106	115	N/A	INTRINSIC
low complexity region	137	148	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	602	789	8.8e-11	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1221	N/A	INTRINSIC
low complexity region	1264	1278	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
SCOP:d1rec__	1378	1530	3e-3	SMART
low complexity region	1605	1624	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160236
AA Change: Q1463L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: Q1463L

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208854

Meta Mutation Damage Score

0.028

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 91.2%

Validation Efficiency

95% (81/85)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	G	A	8: 45,956,478	S268L	probably benign	Het
2310057J18Rik	T	A	10: 28,982,522	I50F	possibly damaging	Het
4930505A04Rik	T	C	11: 30,427,175		probably benign	Het
Aadat	A	T	8: 60,526,680	D192V	possibly damaging	Het
Akap12	A	G	10: 4,353,640	D150G	probably benign	Het
Amigo3	A	T	9: 108,054,032	N218I	probably damaging	Het
Ankmy1	A	G	1: 92,899,651	S60P	probably benign	Het
Apol7e	G	A	15: 77,717,829	S209N	probably damaging	Het
AW551984	A	T	9: 39,599,336	Y234*	probably null	Het
Bcam	A	T	7: 19,760,186	D393E	probably damaging	Het
Card9	A	G	2: 26,354,386	L444P	probably benign	Het
Ccar1	T	C	10: 62,751,001	E886G	unknown	Het
Ccnb2	A	T	9: 70,410,277		probably null	Het
Cd276	T	C	9: 58,535,555	S206G	probably damaging	Het
Cds1	T	A	5: 101,817,962		probably benign	Het
Chuk	T	C	19: 44,077,373	S661G	possibly damaging	Het
Col17a1	T	C	19: 47,650,837	N1090D	probably benign	Het
Col3a1	A	T	1: 45,327,866		probably null	Het
Crispld1	G	T	1: 17,750,800	V355F	possibly damaging	Het
Cspg4	A	T	9: 56,898,867	R2321W	probably damaging	Het
Dner	T	C	1: 84,585,456	T61A	probably benign	Het
Dnmt3a	A	T	12: 3,901,660	Y679F	probably damaging	Het
Dzip3	A	T	16: 48,977,878		probably benign	Het
Eif3l	T	C	15: 79,084,181	S217P	possibly damaging	Het
Fbxo42	T	A	4: 141,198,106		probably benign	Het
Fhod1	A	T	8: 105,337,325		probably benign	Het
Fzd1	T	A	5: 4,756,278	I435F	probably damaging	Het
Gapvd1	C	T	2: 34,712,195	V647I	possibly damaging	Het
Gm14496	T	C	2: 181,996,209	S359P	possibly damaging	Het
Gm5218	C	A	15: 81,499,540		noncoding transcript	Het
Hnrnph3	A	G	10: 63,015,800		probably null	Het
Hsd17b12	G	T	2: 94,033,976	T262K	probably damaging	Het
Igsf10	G	C	3: 59,330,417	P781R	probably damaging	Het
Il11ra1	T	A	4: 41,768,207	S373T	probably damaging	Het
Kdm3b	A	G	18: 34,809,292	D612G	probably damaging	Het
Ldb1	T	C	19: 46,034,464	T261A	probably damaging	Het
Lep	C	A	6: 29,069,090	H47N	possibly damaging	Het
Lrrtm2	A	T	18: 35,213,375	S291R	possibly damaging	Het
Ncor2	T	C	5: 125,084,998	Q404R	unknown	Het
Nlrp4d	T	C	7: 10,382,510	H148R	probably benign	Het
Nlrp9a	T	A	7: 26,558,668	D570E	probably benign	Het
Nphp3	G	A	9: 104,009,214	V202I	probably damaging	Het
Nptn	T	A	9: 58,640,790	N159K	probably benign	Het
Olfr1241	T	A	2: 89,482,971	T55S	probably benign	Het
Olfr1245	A	T	2: 89,575,402	V108D	possibly damaging	Het
Olfr568	G	A	7: 102,877,773	V218I	probably benign	Het
Olfr628	A	T	7: 103,732,378	T151S	possibly damaging	Het
Olfr920	A	T	9: 38,756,420	H244L	probably damaging	Het
Pcolce	T	A	5: 137,610,507	R13*	probably null	Het
Pdgfra	A	G	5: 75,192,603	Y1018C	probably damaging	Het
Prima1	A	G	12: 103,235,595	S74P	probably damaging	Het
Prl7c1	A	G	13: 27,778,855	L55P	probably damaging	Het
Rasef	A	G	4: 73,740,337	V513A	probably damaging	Het
Rgs1	T	C	1: 144,245,489		probably null	Het
Rlf	T	C	4: 121,148,291	E1164G	probably benign	Het
Rnf213	A	T	11: 119,463,345	N4016I	probably damaging	Het
Sae1	C	T	7: 16,330,612		probably null	Het
Serping1	A	T	2: 84,771,504	D207E	probably benign	Het
Setd2	T	A	9: 110,551,396	D33E	unknown	Het
Simc1	T	C	13: 54,525,258	M473T	probably benign	Het
Slc30a6	T	A	17: 74,418,615		probably benign	Het
Slc4a5	T	C	6: 83,265,687	L346P	probably damaging	Het
St3gal3	G	T	4: 117,960,007	A44D	possibly damaging	Het
Sv2b	G	T	7: 75,147,677	T323K	probably damaging	Het
Sycp2	T	A	2: 178,351,668	N1228I	possibly damaging	Het
Thbs2	T	A	17: 14,689,768	M190L	probably benign	Het
Tnrc6a	G	A	7: 123,176,875	V1190I	probably benign	Het
Utrn	A	T	10: 12,436,285	I673K	possibly damaging	Het
Vmn2r114	C	T	17: 23,291,701	V602M	probably damaging	Het
Wdr7	A	T	18: 63,924,918	I1273L	probably benign	Het
Zfp618	T	C	4: 63,132,938	L652P	probably damaging	Het
Zfp804a	G	A	2: 82,053,751		probably benign	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAAGGCCACCAAGTTCTTCATTC -3'
(R):5'- AACTTCCCAGTGAGAGCCCCTATG -3'

Sequencing Primer
(F):5'- cctggcagtggatcatttaaag -3'
(R):5'- GAGAGCCCCTATGTTCTTCCAG -3'

Posted On

2014-04-24