Incidental Mutation 'R1585:Eif3l'
ID177468
Institutional Source Beutler Lab
Gene Symbol Eif3l
Ensembl Gene ENSMUSG00000033047
Gene Nameeukaryotic translation initiation factor 3, subunit L
SynonymsD15N1e, Eif3s6ip, Eif3eip, PAF67, 0610011H21Rik, HSP-66Y
MMRRC Submission 039622-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R1585 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79075179-79094405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79084181 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 217 (S217P)
Ref Sequence ENSEMBL: ENSMUSP00000038839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040518]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040518
AA Change: S217P

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038839
Gene: ENSMUSG00000033047
AA Change: S217P

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
Pfam:Paf67 152 550 7e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230032
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G A 8: 45,956,478 S268L probably benign Het
2310057J18Rik T A 10: 28,982,522 I50F possibly damaging Het
4930505A04Rik T C 11: 30,427,175 probably benign Het
Aadat A T 8: 60,526,680 D192V possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Amigo3 A T 9: 108,054,032 N218I probably damaging Het
Ankmy1 A G 1: 92,899,651 S60P probably benign Het
Apol7e G A 15: 77,717,829 S209N probably damaging Het
AW551984 A T 9: 39,599,336 Y234* probably null Het
Bcam A T 7: 19,760,186 D393E probably damaging Het
Card9 A G 2: 26,354,386 L444P probably benign Het
Ccar1 T C 10: 62,751,001 E886G unknown Het
Ccnb2 A T 9: 70,410,277 probably null Het
Cd276 T C 9: 58,535,555 S206G probably damaging Het
Cds1 T A 5: 101,817,962 probably benign Het
Chuk T C 19: 44,077,373 S661G possibly damaging Het
Col17a1 T C 19: 47,650,837 N1090D probably benign Het
Col3a1 A T 1: 45,327,866 probably null Het
Crispld1 G T 1: 17,750,800 V355F possibly damaging Het
Cspg4 A T 9: 56,898,867 R2321W probably damaging Het
Dner T C 1: 84,585,456 T61A probably benign Het
Dnmt3a A T 12: 3,901,660 Y679F probably damaging Het
Dzip3 A T 16: 48,977,878 probably benign Het
Fbxo42 T A 4: 141,198,106 probably benign Het
Fhod1 A T 8: 105,337,325 probably benign Het
Fzd1 T A 5: 4,756,278 I435F probably damaging Het
Gapvd1 C T 2: 34,712,195 V647I possibly damaging Het
Gm14496 T C 2: 181,996,209 S359P possibly damaging Het
Gm5218 C A 15: 81,499,540 noncoding transcript Het
Hnrnph3 A G 10: 63,015,800 probably null Het
Hsd17b12 G T 2: 94,033,976 T262K probably damaging Het
Igsf10 G C 3: 59,330,417 P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 S373T probably damaging Het
Kdm3b A G 18: 34,809,292 D612G probably damaging Het
Ldb1 T C 19: 46,034,464 T261A probably damaging Het
Lep C A 6: 29,069,090 H47N possibly damaging Het
Lrrtm2 A T 18: 35,213,375 S291R possibly damaging Het
Ncor2 T C 5: 125,084,998 Q404R unknown Het
Nlrp4d T C 7: 10,382,510 H148R probably benign Het
Nlrp9a T A 7: 26,558,668 D570E probably benign Het
Nphp3 G A 9: 104,009,214 V202I probably damaging Het
Nptn T A 9: 58,640,790 N159K probably benign Het
Olfr1241 T A 2: 89,482,971 T55S probably benign Het
Olfr1245 A T 2: 89,575,402 V108D possibly damaging Het
Olfr568 G A 7: 102,877,773 V218I probably benign Het
Olfr628 A T 7: 103,732,378 T151S possibly damaging Het
Olfr920 A T 9: 38,756,420 H244L probably damaging Het
Pcolce T A 5: 137,610,507 R13* probably null Het
Pdgfra A G 5: 75,192,603 Y1018C probably damaging Het
Prima1 A G 12: 103,235,595 S74P probably damaging Het
Prl7c1 A G 13: 27,778,855 L55P probably damaging Het
Rasef A G 4: 73,740,337 V513A probably damaging Het
Rgs1 T C 1: 144,245,489 probably null Het
Rlf T C 4: 121,148,291 E1164G probably benign Het
Rnf213 A T 11: 119,463,345 N4016I probably damaging Het
Sae1 C T 7: 16,330,612 probably null Het
Serping1 A T 2: 84,771,504 D207E probably benign Het
Setd2 T A 9: 110,551,396 D33E unknown Het
Simc1 T C 13: 54,525,258 M473T probably benign Het
Slc30a6 T A 17: 74,418,615 probably benign Het
Slc4a5 T C 6: 83,265,687 L346P probably damaging Het
Spef2 T A 15: 9,596,574 Q1473L probably damaging Het
St3gal3 G T 4: 117,960,007 A44D possibly damaging Het
Sv2b G T 7: 75,147,677 T323K probably damaging Het
Sycp2 T A 2: 178,351,668 N1228I possibly damaging Het
Thbs2 T A 17: 14,689,768 M190L probably benign Het
Tnrc6a G A 7: 123,176,875 V1190I probably benign Het
Utrn A T 10: 12,436,285 I673K possibly damaging Het
Vmn2r114 C T 17: 23,291,701 V602M probably damaging Het
Wdr7 A T 18: 63,924,918 I1273L probably benign Het
Zfp618 T C 4: 63,132,938 L652P probably damaging Het
Zfp804a G A 2: 82,053,751 probably benign Het
Other mutations in Eif3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Eif3l APN 15 79076920 missense possibly damaging 0.82
IGL02457:Eif3l APN 15 79078096 missense probably benign 0.01
IGL02658:Eif3l APN 15 79076942 missense probably damaging 1.00
IGL02689:Eif3l APN 15 79086519 missense possibly damaging 0.77
IGL02797:Eif3l APN 15 79075277 missense probably benign 0.00
IGL02824:Eif3l APN 15 79075823 splice site probably null
IGL02957:Eif3l APN 15 79089828 missense probably benign 0.00
IGL03352:Eif3l APN 15 79077051 unclassified probably benign
R0528:Eif3l UTSW 15 79089609 missense probably benign 0.00
R0550:Eif3l UTSW 15 79076867 missense probably damaging 1.00
R0751:Eif3l UTSW 15 79075766 splice site probably null
R1101:Eif3l UTSW 15 79075267 missense probably damaging 1.00
R1184:Eif3l UTSW 15 79075766 splice site probably null
R1895:Eif3l UTSW 15 79089477 missense possibly damaging 0.55
R2442:Eif3l UTSW 15 79085607 missense probably damaging 1.00
R4865:Eif3l UTSW 15 79081649 nonsense probably null
R5092:Eif3l UTSW 15 79084154 missense probably benign 0.01
R5239:Eif3l UTSW 15 79089795 missense possibly damaging 0.95
R5328:Eif3l UTSW 15 79093361 nonsense probably null
R6575:Eif3l UTSW 15 79086578 missense possibly damaging 0.67
R6624:Eif3l UTSW 15 79089929 missense probably damaging 1.00
R6875:Eif3l UTSW 15 79085560 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAAGCCCGTGTCACCTCATGCTC -3'
(R):5'- GGCCTAAGTTCCGATCCCAAAATCC -3'

Sequencing Primer
(F):5'- CATGCTCTGCATGTGACTG -3'
(R):5'- CCATTTTACGGTAGAGGGTATCAAC -3'
Posted On2014-04-24