Incidental Mutation 'R1586:Abca2'
ID177485
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
MMRRC Submission 039623-MU
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1586 (G1)
Quality Score128
Status Validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25447216 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 2361 (A2361V)
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect probably damaging
Transcript: ENSMUST00000102919
AA Change: A2361V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944
AA Change: A2361V

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199405
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
Abseiling UTSW 2 25447003 missense possibly damaging 0.65
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0372:Abca2 UTSW 2 25437353 missense probably damaging 1.00
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1448:Abca2 UTSW 2 25440530 missense possibly damaging 0.73
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1545:Abca2 UTSW 2 25442358 missense probably benign 0.17
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1635:Abca2 UTSW 2 25444856 missense probably benign 0.03
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1754:Abca2 UTSW 2 25434333 missense probably benign 0.01
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2248:Abca2 UTSW 2 25433464 splice site probably benign
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5840:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6344:Abca2 UTSW 2 25437694 missense probably damaging 1.00
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6980:Abca2 UTSW 2 25440866 missense possibly damaging 0.89
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
R7070:Abca2 UTSW 2 25442995 missense probably benign 0.06
R7080:Abca2 UTSW 2 25446104 missense not run
Predicted Primers PCR Primer
(F):5'- CGAAGGTGCAGTATCAGCTCAAGTC -3'
(R):5'- TGTAGGTCCTTCAGTGTGAGCCTC -3'

Sequencing Primer
(F):5'- AGTCAGAGCACATCTCGCTG -3'
(R):5'- GCTCTTCCTCGAAGCTGATG -3'
Posted On2014-04-24