Incidental Mutation 'R1586:Epha2'
ID177499
Institutional Source Beutler Lab
Gene Symbol Epha2
Ensembl Gene ENSMUSG00000006445
Gene NameEph receptor A2
SynonymsMyk2, Eck, Sek-2, Sek2
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R1586 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141301240-141329384 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 141318605 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006614]
Predicted Effect probably benign
Transcript: ENSMUST00000006614
SMART Domains Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EPH_lbd 27 200 1.31e-112 SMART
FN3 330 420 1.16e-6 SMART
FN3 437 517 3.73e-10 SMART
Pfam:EphA2_TM 538 611 5.9e-22 PFAM
TyrKc 614 872 2.23e-135 SMART
SAM 902 969 1.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149002
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Epha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Epha2 APN 4 141318524 missense probably damaging 1.00
IGL02812:Epha2 APN 4 141318919 splice site probably benign
IGL03377:Epha2 APN 4 141322412 missense probably benign 0.08
R0165:Epha2 UTSW 4 141321892 critical splice donor site probably null
R0321:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R1584:Epha2 UTSW 4 141322047 intron probably null
R1695:Epha2 UTSW 4 141306517 missense possibly damaging 0.74
R1721:Epha2 UTSW 4 141322652 missense probably damaging 1.00
R1731:Epha2 UTSW 4 141321752 missense possibly damaging 0.81
R1813:Epha2 UTSW 4 141308546 missense possibly damaging 0.86
R1875:Epha2 UTSW 4 141308979 missense probably benign 0.02
R2226:Epha2 UTSW 4 141321237 missense probably damaging 1.00
R2314:Epha2 UTSW 4 141319014 missense probably damaging 1.00
R2342:Epha2 UTSW 4 141323531 missense probably benign 0.00
R3872:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R3927:Epha2 UTSW 4 141306550 missense probably damaging 1.00
R4688:Epha2 UTSW 4 141318981 missense probably benign
R4795:Epha2 UTSW 4 141322416 splice site probably null
R4974:Epha2 UTSW 4 141321705 missense probably damaging 0.99
R5055:Epha2 UTSW 4 141309069 missense probably benign 0.09
R5123:Epha2 UTSW 4 141308865 missense possibly damaging 0.71
R5424:Epha2 UTSW 4 141318940 nonsense probably null
R5522:Epha2 UTSW 4 141308556 missense probably damaging 1.00
R5657:Epha2 UTSW 4 141323494 missense probably damaging 1.00
R5717:Epha2 UTSW 4 141322071 missense probably benign
R5864:Epha2 UTSW 4 141308427 missense probably damaging 0.98
R6151:Epha2 UTSW 4 141318480 critical splice acceptor site probably null
R6244:Epha2 UTSW 4 141316912 missense probably benign 0.00
R6288:Epha2 UTSW 4 141317033 missense probably benign 0.01
R6696:Epha2 UTSW 4 141321539 missense probably benign
R6817:Epha2 UTSW 4 141308994 missense probably damaging 0.98
R6875:Epha2 UTSW 4 141328468 missense probably damaging 1.00
R6910:Epha2 UTSW 4 141321513 missense probably damaging 1.00
R6925:Epha2 UTSW 4 141308757 missense probably benign
R7330:Epha2 UTSW 4 141308453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGGCAGCATCCATAACAGGAC -3'
(R):5'- AGTACAGATTCACCAGAGGCCAGAG -3'

Sequencing Primer
(F):5'- GAACCCCATGCAGGATCTGAG -3'
(R):5'- CCAGAGGGGGACTATACATCC -3'
Posted On2014-04-24