Incidental Mutation 'R1587:Zhx3'
ID177548
Institutional Source Beutler Lab
Gene Symbol Zhx3
Ensembl Gene ENSMUSG00000035877
Gene Namezinc fingers and homeoboxes 3
Synonyms9530010N21Rik, 4932418O04Rik, Tix1, 1810059C13Rik
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1587 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160748708-160872998 bp(-) (GRCm38)
Type of Mutationunclassified (211 bp from exon)
DNA Base Change (assembly) T to C at 160781693 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000109460] [ENSMUST00000127201] [ENSMUST00000176141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103111
AA Change: I185V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877
AA Change: I185V

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103112
AA Change: I185V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877
AA Change: I185V

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109460
AA Change: I185V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105086
Gene: ENSMUSG00000035877
AA Change: I185V

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 841 888 1.3e-17 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127201
SMART Domains Protein: ENSMUSP00000120488
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect probably null
Transcript: ENSMUST00000176141
SMART Domains Protein: ENSMUSP00000134763
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc fingers and homeoboxes (ZHX) gene family. The encoded protein contains two C2H2-type zinc fingers and five homeodomains and forms a dimer with itself or with zinc fingers and homeoboxes family member 1. In the nucleus, the dimerized protein interacts with the A subunit of the ubiquitous transcription factor nuclear factor-Y and may function as a transcriptional repressor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Other mutations in Zhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zhx3 APN 2 160780841 missense probably damaging 0.99
IGL01759:Zhx3 APN 2 160780714 missense probably damaging 1.00
IGL02170:Zhx3 APN 2 160779798 missense probably damaging 1.00
IGL02550:Zhx3 APN 2 160781296 missense probably damaging 1.00
R0497:Zhx3 UTSW 2 160779994 nonsense probably null
R0882:Zhx3 UTSW 2 160780709 missense probably damaging 1.00
R1396:Zhx3 UTSW 2 160781020 missense possibly damaging 0.90
R1646:Zhx3 UTSW 2 160781275 missense probably damaging 1.00
R1822:Zhx3 UTSW 2 160780355 missense probably benign 0.03
R2322:Zhx3 UTSW 2 160782028 missense probably damaging 1.00
R3791:Zhx3 UTSW 2 160780448 missense possibly damaging 0.94
R3899:Zhx3 UTSW 2 160780451 missense possibly damaging 0.82
R4003:Zhx3 UTSW 2 160780889 missense probably damaging 0.96
R4619:Zhx3 UTSW 2 160781959 missense probably damaging 0.96
R5307:Zhx3 UTSW 2 160779868 missense probably benign 0.02
R5461:Zhx3 UTSW 2 160780018 missense probably benign
R5648:Zhx3 UTSW 2 160781961 missense probably damaging 1.00
R5952:Zhx3 UTSW 2 160782017 missense probably damaging 1.00
R6035:Zhx3 UTSW 2 160779543 missense probably benign
R6035:Zhx3 UTSW 2 160779543 missense probably benign
R6734:Zhx3 UTSW 2 160781720 missense probably damaging 0.99
R6988:Zhx3 UTSW 2 160779868 missense probably benign 0.02
R7032:Zhx3 UTSW 2 160780978 missense probably damaging 1.00
R7288:Zhx3 UTSW 2 160781122 missense probably damaging 1.00
Z1088:Zhx3 UTSW 2 160779755 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCAAGACAGGCACTGTTCCTATC -3'
(R):5'- CCCTGCATAATGCCAAGTGTCACTC -3'

Sequencing Primer
(F):5'- CCATTGGCAGCAGGAGG -3'
(R):5'- TCACTCAGGGGAAGCCAG -3'
Posted On2014-04-24