Incidental Mutation 'R1587:2810474O19Rik'
ID177565
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 039624-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1587 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 149326520 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 355 (V355F)
Ref Sequence ENSEMBL: ENSMUSP00000115573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect probably damaging
Transcript: ENSMUST00000046689
AA Change: V355F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: V355F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100765
AA Change: V355F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: V355F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably damaging
Transcript: ENSMUST00000130664
AA Change: V355F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably damaging
Transcript: ENSMUST00000189837
AA Change: V355F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: V355F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189932
AA Change: V355F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: V355F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190785
AA Change: V355F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: V355F

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAACATGTGCAGAATGCTCAGC -3'
(R):5'- TCACAGCTCGGTATGAGAACTGGC -3'

Sequencing Primer
(F):5'- GCCTATGGAAGTTCCTCAGAG -3'
(R):5'- GATTGGCACTGCCCACTAC -3'
Posted On2014-04-24