Incidental Mutation 'R1587:Eno3'
ID177585
Institutional Source Beutler Lab
Gene Symbol Eno3
Ensembl Gene ENSMUSG00000060600
Gene Nameenolase 3, beta muscle
SynonymsEno-3
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R1587 (G1)
Quality Score196
Status Not validated
Chromosome11
Chromosomal Location70657202-70662513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70661470 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 316 (V316A)
Ref Sequence ENSEMBL: ENSMUSP00000128714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000072841] [ENSMUST00000108548] [ENSMUST00000126241] [ENSMUST00000129434] [ENSMUST00000134087] [ENSMUST00000157027] [ENSMUST00000170716]
Predicted Effect probably benign
Transcript: ENSMUST00000018431
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072841
AA Change: V316A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072620
Gene: ENSMUSG00000060600
AA Change: V316A

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108548
AA Change: V316A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104188
Gene: ENSMUSG00000060600
AA Change: V316A

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124691
Predicted Effect probably benign
Transcript: ENSMUST00000126241
SMART Domains Protein: ENSMUSP00000123688
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 70 7.82e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129434
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131642
Predicted Effect probably benign
Transcript: ENSMUST00000134087
SMART Domains Protein: ENSMUSP00000121640
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 78 3.53e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137691
Predicted Effect probably benign
Transcript: ENSMUST00000157027
SMART Domains Protein: ENSMUSP00000115726
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Pfam:Enolase_C 142 196 1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170716
AA Change: V316A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128714
Gene: ENSMUSG00000060600
AA Change: V316A

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect unknown
Transcript: ENSMUST00000179055
AA Change: V96A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179738
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of the three enolase isoenzymes found in vertebrates. Enolase is a dimeric enzyme that converts 2-phosphoglycerate to phosphoenolpyruvate as part of the glycolytic pathway. This isozyme is found in skeletal muscle where it is involved in muscle development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Eno3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Eno3 APN 11 70660888 splice site probably benign
IGL02591:Eno3 APN 11 70662027 missense probably damaging 1.00
IGL02868:Eno3 APN 11 70662000 missense probably damaging 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0970:Eno3 UTSW 11 70660802 missense probably damaging 1.00
R1518:Eno3 UTSW 11 70661077 nonsense probably null
R1663:Eno3 UTSW 11 70662274 critical splice donor site probably null
R1675:Eno3 UTSW 11 70658666 critical splice donor site probably null
R1758:Eno3 UTSW 11 70661425 missense possibly damaging 0.77
R3983:Eno3 UTSW 11 70661411 missense probably damaging 0.98
R4990:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R4992:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R5170:Eno3 UTSW 11 70662214 missense probably benign 0.00
R6116:Eno3 UTSW 11 70661575 missense possibly damaging 0.70
R6917:Eno3 UTSW 11 70661436 missense probably benign
R7060:Eno3 UTSW 11 70661419 missense possibly damaging 0.95
R7128:Eno3 UTSW 11 70658604 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACTTCAAGTCACCCGATGACCCTG -3'
(R):5'- GCCACAATGGCAAAAGTCTTAGAGC -3'

Sequencing Primer
(F):5'- GGTTACCTAGCATGGCTCTCAG -3'
(R):5'- CCAAGTTGGGGGTCAGTCATAG -3'
Posted On2014-04-24