Incidental Mutation 'R1587:A530064D06Rik'
ID177603
Institutional Source Beutler Lab
Gene Symbol A530064D06Rik
Ensembl Gene ENSMUSG00000043939
Gene NameRIKEN cDNA A530064D06 gene
Synonyms
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1587 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location48151896-48167270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48166417 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 111 (S111T)
Ref Sequence ENSEMBL: ENSMUSP00000055935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027764] [ENSMUST00000053612]
Predicted Effect probably benign
Transcript: ENSMUST00000027764
AA Change: S111T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027764
Gene: ENSMUSG00000043939
AA Change: S111T

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 1.56e-5 SMART
low complexity region 144 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053612
AA Change: S111T

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055935
Gene: ENSMUSG00000043939
AA Change: S111T

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 1.56e-5 SMART
low complexity region 147 166 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in A530064D06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:A530064D06Rik APN 17 48152940 missense probably damaging 0.99
IGL01761:A530064D06Rik APN 17 48152959 missense possibly damaging 0.91
IGL02001:A530064D06Rik APN 17 48166674 missense possibly damaging 0.74
IGL02995:A530064D06Rik APN 17 48163288 missense probably benign 0.23
IGL03109:A530064D06Rik APN 17 48166460 missense probably benign 0.13
FR4340:A530064D06Rik UTSW 17 48163381 small deletion probably benign
FR4589:A530064D06Rik UTSW 17 48163381 small deletion probably benign
IGL02984:A530064D06Rik UTSW 17 48163280 missense probably benign 0.06
R0206:A530064D06Rik UTSW 17 48163318 missense probably benign 0.00
R0206:A530064D06Rik UTSW 17 48163318 missense probably benign 0.00
R0660:A530064D06Rik UTSW 17 48166591 missense probably benign 0.18
R0664:A530064D06Rik UTSW 17 48166591 missense probably benign 0.18
R0671:A530064D06Rik UTSW 17 48166656 missense probably benign 0.05
R4087:A530064D06Rik UTSW 17 48166510 missense probably damaging 0.96
R4089:A530064D06Rik UTSW 17 48166510 missense probably damaging 0.96
R4963:A530064D06Rik UTSW 17 48163414 missense probably benign 0.34
R5060:A530064D06Rik UTSW 17 48166939 missense probably damaging 1.00
R5083:A530064D06Rik UTSW 17 48166390 missense possibly damaging 0.86
R5219:A530064D06Rik UTSW 17 48163350 missense possibly damaging 0.70
R6175:A530064D06Rik UTSW 17 48152848 missense possibly damaging 0.91
R6189:A530064D06Rik UTSW 17 48167054 start gained probably benign
R6420:A530064D06Rik UTSW 17 48166398 missense probably damaging 1.00
R6439:A530064D06Rik UTSW 17 48166485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCCCGAGACACTAGCAAGCC -3'
(R):5'- TGTGTTACCCCTTCGTCAGCAAAAG -3'

Sequencing Primer
(F):5'- tgtcaaacttcctaatgctgtg -3'
(R):5'- TTCGTCAGCAAAAGTGCCG -3'
Posted On2014-04-24