Incidental Mutation 'R1587:Ablim1'
ID177608
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Nameactin-binding LIM protein 1
Synonyms2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1
MMRRC Submission 039624-MU
Accession Numbers

Genbank: NM_178688; MGI: 1194500

Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R1587 (G1)
Quality Score183
Status Not validated
Chromosome19
Chromosomal Location57032733-57314919 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to T at 57083547 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000107153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000104902] [ENSMUST00000111526] [ENSMUST00000111528] [ENSMUST00000111529] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079360
AA Change: M317I

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085
AA Change: M317I

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099294
AA Change: M241I

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085
AA Change: M241I

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000104902
AA Change: M1I

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127818
Gene: ENSMUSG00000025085
AA Change: M1I

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 1e-8 PDB
low complexity region 88 97 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
coiled coil region 358 382 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
VHP 510 545 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111526
AA Change: M1I

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107151
Gene: ENSMUSG00000025085
AA Change: M1I

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
PDB:1WIG|A 1 28 6e-9 PDB
coiled coil region 213 237 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
VHP 365 400 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111528
AA Change: M1I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107153
Gene: ENSMUSG00000025085
AA Change: M1I

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 72 81 N/A INTRINSIC
coiled coil region 267 291 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
VHP 419 454 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111529
AA Change: M1I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107154
Gene: ENSMUSG00000025085
AA Change: M1I

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 44 53 N/A INTRINSIC
coiled coil region 239 263 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
VHP 391 426 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111544
AA Change: M241I

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085
AA Change: M241I

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111546
AA Change: M241I

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085
AA Change: M241I

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111550
AA Change: M241I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085
AA Change: M241I

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111555
AA Change: M317I

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085
AA Change: M317I

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111558
AA Change: M254I

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085
AA Change: M254I

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111559
AA Change: M254I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085
AA Change: M254I

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156316
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57152290 missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57061328 missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57215721 missense probably benign
IGL01385:Ablim1 APN 19 57068914 missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57039447 missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57134654 missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57079880 splice site probably benign
IGL02498:Ablim1 APN 19 57152319 nonsense probably null
A9681:Ablim1 UTSW 19 57173323 critical splice donor site probably null
R0089:Ablim1 UTSW 19 57043031 missense probably damaging 1.00
R0226:Ablim1 UTSW 19 57043870 missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57134633 missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57068236 missense probably damaging 1.00
R1588:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57215965 start gained probably null
R1936:Ablim1 UTSW 19 57215965 start gained probably null
R2021:Ablim1 UTSW 19 57047018 missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57043813 missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57077431 missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57152359 missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57152303 missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3733:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3734:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3878:Ablim1 UTSW 19 57037210 utr 3 prime probably null
R4354:Ablim1 UTSW 19 57155278 missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57077442 missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57215721 missense probably benign
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R5277:Ablim1 UTSW 19 57155261 missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57155249 missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57130923 missense probably benign 0.07
R5893:Ablim1 UTSW 19 57215853 missense probably benign 0.07
R5958:Ablim1 UTSW 19 57041935 missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57061355 missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57079839 missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57130852 missense probably benign 0.03
R6662:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R6705:Ablim1 UTSW 19 57215821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGAGGTAGCTCTAGCACATGCCC -3'
(R):5'- AGAGACAAGGCCACCGTCATTCTG -3'

Sequencing Primer
(F):5'- TAGCACATGCCCGATGGATTTAG -3'
(R):5'- TTACCATTTGGGCCAACAGAG -3'
Posted On2014-04-24