Incidental Mutation 'R1588:Sf3b1'
ID177609
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Namesplicing factor 3b, subunit 1
SynonymsTarg4, SAP155, Prp10, 2810001M05Rik, SF3b155
MMRRC Submission 039625-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1588 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54985169-55027481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54997177 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 912 (N912K)
Ref Sequence ENSEMBL: ENSMUSP00000027127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127]
Predicted Effect probably benign
Transcript: ENSMUST00000027127
AA Change: N912K

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: N912K

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185429
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Adamts13 A T 2: 26,975,675 I81F probably benign Het
Akap11 A T 14: 78,510,245 N1567K possibly damaging Het
Arrdc4 G A 7: 68,741,736 T261M possibly damaging Het
C4b T C 17: 34,741,025 I326V probably benign Het
Casp8ap2 G A 4: 32,640,541 A532T probably benign Het
Ccdc129 A G 6: 55,978,503 E1032G possibly damaging Het
Ccdc134 A G 15: 82,135,136 T187A probably benign Het
Cdh8 T C 8: 99,190,407 N359D probably damaging Het
Cep97 A G 16: 55,927,821 L82P probably damaging Het
Cfap53 A T 18: 74,307,373 R404S probably benign Het
Chrng C A 1: 87,207,507 F179L probably damaging Het
Ddi1 A T 9: 6,265,391 I326K probably damaging Het
Decr2 T C 17: 26,083,028 T243A possibly damaging Het
Dip2c T C 13: 9,665,864 V1502A probably damaging Het
Edem1 T C 6: 108,841,679 V216A probably damaging Het
Fat2 A C 11: 55,283,404 V2161G probably damaging Het
Fbn1 T C 2: 125,319,114 T2169A probably benign Het
Fmn1 T C 2: 113,365,698 V581A unknown Het
Gm13088 G T 4: 143,655,551 L192M probably damaging Het
Hip1r A T 5: 123,996,575 D350V probably damaging Het
Ift140 G A 17: 25,087,985 R898H probably damaging Het
Il12a A G 3: 68,695,563 I159V probably benign Het
Kl A G 5: 150,982,632 E489G probably benign Het
Klhl3 T C 13: 58,013,898 E461G probably damaging Het
Masp1 T C 16: 23,494,654 Y177C probably damaging Het
Nop58 T A 1: 59,702,872 Y187N probably damaging Het
Npc1l1 A G 11: 6,217,785 V1002A probably benign Het
Ntrk1 A T 3: 87,780,077 Y683* probably null Het
Olfr1053 T C 2: 86,314,530 Y252C probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Olfr71 C T 4: 43,705,923 C215Y probably damaging Het
Olfr742 A G 14: 50,516,127 I308V probably benign Het
Osbpl6 T C 2: 76,579,216 V367A probably benign Het
Phip A G 9: 82,900,828 W855R probably damaging Het
Phlpp1 A G 1: 106,380,385 S1131G probably damaging Het
Pkdrej A T 15: 85,817,241 V1498E probably benign Het
Prkaa2 T C 4: 105,051,223 N152D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,002,559 V732M probably damaging Het
Rccd1 C T 7: 80,320,111 W223* probably null Het
Riox2 T A 16: 59,475,583 S16T possibly damaging Het
Scn5a C T 9: 119,521,301 V836I probably damaging Het
Serpinf1 G A 11: 75,410,250 R380C probably damaging Het
Shprh T A 10: 11,164,744 C134S probably damaging Het
Skint8 T A 4: 111,928,727 C123* probably null Het
Slc16a13 G T 11: 70,218,595 S360* probably null Het
Srr A G 11: 74,908,803 I282T possibly damaging Het
Trpm1 T C 7: 64,223,817 F607L possibly damaging Het
Ttn T C 2: 76,709,526 D34372G probably benign Het
Tub C T 7: 109,029,681 T401I probably damaging Het
Wdhd1 T C 14: 47,256,236 E9G probably damaging Het
Wdyhv1 T A 15: 58,157,889 probably null Het
Yipf3 T A 17: 46,250,861 F198Y possibly damaging Het
Zfp955a C T 17: 33,241,817 R447K probably benign Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 54987486 missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 54996931 splice site probably benign
IGL01380:Sf3b1 APN 1 54987949 missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 54987429 missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55007707 missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55012213 missense probably benign
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0190:Sf3b1 UTSW 1 54990306 missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0369:Sf3b1 UTSW 1 54998108 missense probably benign 0.10
R0396:Sf3b1 UTSW 1 55019271 missense probably damaging 1.00
R0718:Sf3b1 UTSW 1 55019385 missense probably damaging 0.99
R0991:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1082:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55019265 missense probably damaging 0.99
R1376:Sf3b1 UTSW 1 55019265 missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55003154 missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55001421 missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1625:Sf3b1 UTSW 1 55019377 missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55000652 missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 54998188 missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55007633 missense probably benign
R2429:Sf3b1 UTSW 1 55016801 missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 54999626 critical splice donor site probably null
R3772:Sf3b1 UTSW 1 54999991 intron probably benign
R3911:Sf3b1 UTSW 1 55019389 nonsense probably null
R3970:Sf3b1 UTSW 1 55012182 nonsense probably null
R4706:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 54999712 missense probably benign
R5053:Sf3b1 UTSW 1 54997177 missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55003310 missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55003150 missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 54998175 missense probably benign 0.27
R5636:Sf3b1 UTSW 1 54997193 missense probably damaging 1.00
R6013:Sf3b1 UTSW 1 55000298 missense probably damaging 0.98
R6149:Sf3b1 UTSW 1 55007507 missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55007518 missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 54999655 missense probably benign 0.01
R6531:Sf3b1 UTSW 1 55019395 missense probably damaging 0.99
R6945:Sf3b1 UTSW 1 54997156 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CACCCAAGTGCCCCATCAGTTT -3'
(R):5'- GACATTTTAGTGACCAGTTGTCCTCAGT -3'

Sequencing Primer
(F):5'- TCTGGTAGAATAGATTACCTCTTGAC -3'
(R):5'- AGTGACCAGTTGTCCTCAGTTTAAC -3'
Posted On2014-04-24