Incidental Mutation 'R1588:Chrng'
ID177612
Institutional Source Beutler Lab
Gene Symbol Chrng
Ensembl Gene ENSMUSG00000026253
Gene Namecholinergic receptor, nicotinic, gamma polypeptide
SynonymsAcrg, Achr-3
MMRRC Submission 039625-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1588 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87204657-87212694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87207507 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 179 (F179L)
Ref Sequence ENSEMBL: ENSMUSP00000141001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027470] [ENSMUST00000185763] [ENSMUST00000186038] [ENSMUST00000188796]
Predicted Effect probably damaging
Transcript: ENSMUST00000027470
AA Change: F157L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027470
Gene: ENSMUSG00000026253
AA Change: F157L

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 241 7.9e-72 PFAM
Pfam:Neur_chan_memb 248 494 9.6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185763
AA Change: F214L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139600
Gene: ENSMUSG00000026253
AA Change: F214L

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 20 72 1.4e-6 PFAM
Pfam:Neur_chan_LBD 117 255 1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186038
AA Change: F179L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141001
Gene: ENSMUSG00000026253
AA Change: F179L

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 220 1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188796
SMART Domains Protein: ENSMUSP00000140796
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 142 1.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189392
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian muscle-type acetylcholine receptor is a transmembrane pentameric glycoprotein with two alpha subunits, one beta, one delta, and one epsilon (in adult skeletal muscle) or gamma (in fetal and denervated muscle) subunit. This gene, which encodes the gamma subunit, is expressed prior to the thirty-third week of gestation in humans. The gamma subunit of the acetylcholine receptor plays a role in neuromuscular organogenesis and ligand binding and disruption of gamma subunit expression prevents the correct localization of the receptor in cell membranes. Mutations in this gene cause Escobar syndrome and a lethal form of multiple pterygium syndrome. Muscle-type acetylcholine receptor is the major antigen in the autoimmune disease myasthenia gravis.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display perinatal and postnatal lethality, paradoxical breathing, abnormal skeletal muscle morphology, abnormal neuromuscular junction morphology and physiology, and are unable to suckle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Adamts13 A T 2: 26,975,675 I81F probably benign Het
Akap11 A T 14: 78,510,245 N1567K possibly damaging Het
Arrdc4 G A 7: 68,741,736 T261M possibly damaging Het
C4b T C 17: 34,741,025 I326V probably benign Het
Casp8ap2 G A 4: 32,640,541 A532T probably benign Het
Ccdc129 A G 6: 55,978,503 E1032G possibly damaging Het
Ccdc134 A G 15: 82,135,136 T187A probably benign Het
Cdh8 T C 8: 99,190,407 N359D probably damaging Het
Cep97 A G 16: 55,927,821 L82P probably damaging Het
Cfap53 A T 18: 74,307,373 R404S probably benign Het
Ddi1 A T 9: 6,265,391 I326K probably damaging Het
Decr2 T C 17: 26,083,028 T243A possibly damaging Het
Dip2c T C 13: 9,665,864 V1502A probably damaging Het
Edem1 T C 6: 108,841,679 V216A probably damaging Het
Fat2 A C 11: 55,283,404 V2161G probably damaging Het
Fbn1 T C 2: 125,319,114 T2169A probably benign Het
Fmn1 T C 2: 113,365,698 V581A unknown Het
Gm13088 G T 4: 143,655,551 L192M probably damaging Het
Hip1r A T 5: 123,996,575 D350V probably damaging Het
Ift140 G A 17: 25,087,985 R898H probably damaging Het
Il12a A G 3: 68,695,563 I159V probably benign Het
Kl A G 5: 150,982,632 E489G probably benign Het
Klhl3 T C 13: 58,013,898 E461G probably damaging Het
Masp1 T C 16: 23,494,654 Y177C probably damaging Het
Nop58 T A 1: 59,702,872 Y187N probably damaging Het
Npc1l1 A G 11: 6,217,785 V1002A probably benign Het
Ntrk1 A T 3: 87,780,077 Y683* probably null Het
Olfr1053 T C 2: 86,314,530 Y252C probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Olfr71 C T 4: 43,705,923 C215Y probably damaging Het
Olfr742 A G 14: 50,516,127 I308V probably benign Het
Osbpl6 T C 2: 76,579,216 V367A probably benign Het
Phip A G 9: 82,900,828 W855R probably damaging Het
Phlpp1 A G 1: 106,380,385 S1131G probably damaging Het
Pkdrej A T 15: 85,817,241 V1498E probably benign Het
Prkaa2 T C 4: 105,051,223 N152D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,002,559 V732M probably damaging Het
Rccd1 C T 7: 80,320,111 W223* probably null Het
Riox2 T A 16: 59,475,583 S16T possibly damaging Het
Scn5a C T 9: 119,521,301 V836I probably damaging Het
Serpinf1 G A 11: 75,410,250 R380C probably damaging Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shprh T A 10: 11,164,744 C134S probably damaging Het
Skint8 T A 4: 111,928,727 C123* probably null Het
Slc16a13 G T 11: 70,218,595 S360* probably null Het
Srr A G 11: 74,908,803 I282T possibly damaging Het
Trpm1 T C 7: 64,223,817 F607L possibly damaging Het
Ttn T C 2: 76,709,526 D34372G probably benign Het
Tub C T 7: 109,029,681 T401I probably damaging Het
Wdhd1 T C 14: 47,256,236 E9G probably damaging Het
Wdyhv1 T A 15: 58,157,889 probably null Het
Yipf3 T A 17: 46,250,861 F198Y possibly damaging Het
Zfp955a C T 17: 33,241,817 R447K probably benign Het
Other mutations in Chrng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Chrng APN 1 87206747 missense probably damaging 0.99
IGL02947:Chrng APN 1 87209884 unclassified probably null
IGL03014:Chrng UTSW 1 87211037 critical splice donor site probably null
R1051:Chrng UTSW 1 87209063 missense possibly damaging 0.70
R1346:Chrng UTSW 1 87208263 missense probably benign 0.09
R1368:Chrng UTSW 1 87205853 missense probably damaging 1.00
R1703:Chrng UTSW 1 87210906 missense possibly damaging 0.63
R2852:Chrng UTSW 1 87206706 missense probably benign 0.01
R3707:Chrng UTSW 1 87210611 nonsense probably null
R4780:Chrng UTSW 1 87207524 missense probably damaging 1.00
R5818:Chrng UTSW 1 87209801 missense probably benign 0.45
R5871:Chrng UTSW 1 87206729 missense possibly damaging 0.95
R6058:Chrng UTSW 1 87211352 missense probably damaging 1.00
R6136:Chrng UTSW 1 87209801 missense probably benign 0.45
T0975:Chrng UTSW 1 87210626 missense probably benign 0.00
X0063:Chrng UTSW 1 87206706 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTCTGTACACTGGCCTATGCAC -3'
(R):5'- GGCATACCCAGATGTTCTTAGCCAC -3'

Sequencing Primer
(F):5'- CCTATGCACACAGTGTGGAC -3'
(R):5'- AGACAATAGGGTCTCCCCTTGG -3'
Posted On2014-04-24