Incidental Mutation 'R1588:Casp8ap2'
ID177625
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
MMRRC Submission 039625-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1588 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32640541 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 532 (A532T)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect probably benign
Transcript: ENSMUST00000029950
AA Change: A532T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: A532T

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127619
Predicted Effect probably benign
Transcript: ENSMUST00000178925
AA Change: A532T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: A532T

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Adamts13 A T 2: 26,975,675 I81F probably benign Het
Akap11 A T 14: 78,510,245 N1567K possibly damaging Het
Arrdc4 G A 7: 68,741,736 T261M possibly damaging Het
C4b T C 17: 34,741,025 I326V probably benign Het
Ccdc129 A G 6: 55,978,503 E1032G possibly damaging Het
Ccdc134 A G 15: 82,135,136 T187A probably benign Het
Cdh8 T C 8: 99,190,407 N359D probably damaging Het
Cep97 A G 16: 55,927,821 L82P probably damaging Het
Cfap53 A T 18: 74,307,373 R404S probably benign Het
Chrng C A 1: 87,207,507 F179L probably damaging Het
Ddi1 A T 9: 6,265,391 I326K probably damaging Het
Decr2 T C 17: 26,083,028 T243A possibly damaging Het
Dip2c T C 13: 9,665,864 V1502A probably damaging Het
Edem1 T C 6: 108,841,679 V216A probably damaging Het
Fat2 A C 11: 55,283,404 V2161G probably damaging Het
Fbn1 T C 2: 125,319,114 T2169A probably benign Het
Fmn1 T C 2: 113,365,698 V581A unknown Het
Gm13088 G T 4: 143,655,551 L192M probably damaging Het
Hip1r A T 5: 123,996,575 D350V probably damaging Het
Ift140 G A 17: 25,087,985 R898H probably damaging Het
Il12a A G 3: 68,695,563 I159V probably benign Het
Kl A G 5: 150,982,632 E489G probably benign Het
Klhl3 T C 13: 58,013,898 E461G probably damaging Het
Masp1 T C 16: 23,494,654 Y177C probably damaging Het
Nop58 T A 1: 59,702,872 Y187N probably damaging Het
Npc1l1 A G 11: 6,217,785 V1002A probably benign Het
Ntrk1 A T 3: 87,780,077 Y683* probably null Het
Olfr1053 T C 2: 86,314,530 Y252C probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Olfr71 C T 4: 43,705,923 C215Y probably damaging Het
Olfr742 A G 14: 50,516,127 I308V probably benign Het
Osbpl6 T C 2: 76,579,216 V367A probably benign Het
Phip A G 9: 82,900,828 W855R probably damaging Het
Phlpp1 A G 1: 106,380,385 S1131G probably damaging Het
Pkdrej A T 15: 85,817,241 V1498E probably benign Het
Prkaa2 T C 4: 105,051,223 N152D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,002,559 V732M probably damaging Het
Rccd1 C T 7: 80,320,111 W223* probably null Het
Riox2 T A 16: 59,475,583 S16T possibly damaging Het
Scn5a C T 9: 119,521,301 V836I probably damaging Het
Serpinf1 G A 11: 75,410,250 R380C probably damaging Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shprh T A 10: 11,164,744 C134S probably damaging Het
Skint8 T A 4: 111,928,727 C123* probably null Het
Slc16a13 G T 11: 70,218,595 S360* probably null Het
Srr A G 11: 74,908,803 I282T possibly damaging Het
Trpm1 T C 7: 64,223,817 F607L possibly damaging Het
Ttn T C 2: 76,709,526 D34372G probably benign Het
Tub C T 7: 109,029,681 T401I probably damaging Het
Wdhd1 T C 14: 47,256,236 E9G probably damaging Het
Wdyhv1 T A 15: 58,157,889 probably null Het
Yipf3 T A 17: 46,250,861 F198Y possibly damaging Het
Zfp955a C T 17: 33,241,817 R447K probably benign Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTTAGTGTTGCACACCAGTGGG -3'
(R):5'- TGAGATGTTGCCAAAAGAGCCTCC -3'

Sequencing Primer
(F):5'- GTGGGAAAATACTCCTTTCAAAGCAG -3'
(R):5'- CTCTATTATGTTCACTGCCAGAAGG -3'
Posted On2014-04-24