Incidental Mutation 'R1588:Arrdc4'
ID177640
Institutional Source Beutler Lab
Gene Symbol Arrdc4
Ensembl Gene ENSMUSG00000042659
Gene Namearrestin domain containing 4
Synonyms
MMRRC Submission 039625-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R1588 (G1)
Quality Score196
Status Not validated
Chromosome7
Chromosomal Location68736995-68749241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68741736 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 261 (T261M)
Ref Sequence ENSEMBL: ENSMUSP00000112962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048068] [ENSMUST00000118110]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048068
AA Change: T261M

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044578
Gene: ENSMUSG00000042659
AA Change: T261M

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 166 6.2e-35 PFAM
Arrestin_C 188 315 8.24e-30 SMART
low complexity region 336 348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118110
AA Change: T261M

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112962
Gene: ENSMUSG00000042659
AA Change: T261M

DomainStartEndE-ValueType
Pfam:Arrestin_N 17 166 6.6e-35 PFAM
Arrestin_C 188 296 6.46e-14 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show a marked reduction in the amount of extracellular vesicles (EVs) released from mouse gut explants. Mutant mouse embryonic fibroblasts exhibit reduced EV release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Adamts13 A T 2: 26,975,675 I81F probably benign Het
Akap11 A T 14: 78,510,245 N1567K possibly damaging Het
C4b T C 17: 34,741,025 I326V probably benign Het
Casp8ap2 G A 4: 32,640,541 A532T probably benign Het
Ccdc129 A G 6: 55,978,503 E1032G possibly damaging Het
Ccdc134 A G 15: 82,135,136 T187A probably benign Het
Cdh8 T C 8: 99,190,407 N359D probably damaging Het
Cep97 A G 16: 55,927,821 L82P probably damaging Het
Cfap53 A T 18: 74,307,373 R404S probably benign Het
Chrng C A 1: 87,207,507 F179L probably damaging Het
Ddi1 A T 9: 6,265,391 I326K probably damaging Het
Decr2 T C 17: 26,083,028 T243A possibly damaging Het
Dip2c T C 13: 9,665,864 V1502A probably damaging Het
Edem1 T C 6: 108,841,679 V216A probably damaging Het
Fat2 A C 11: 55,283,404 V2161G probably damaging Het
Fbn1 T C 2: 125,319,114 T2169A probably benign Het
Fmn1 T C 2: 113,365,698 V581A unknown Het
Gm13088 G T 4: 143,655,551 L192M probably damaging Het
Hip1r A T 5: 123,996,575 D350V probably damaging Het
Ift140 G A 17: 25,087,985 R898H probably damaging Het
Il12a A G 3: 68,695,563 I159V probably benign Het
Kl A G 5: 150,982,632 E489G probably benign Het
Klhl3 T C 13: 58,013,898 E461G probably damaging Het
Masp1 T C 16: 23,494,654 Y177C probably damaging Het
Nop58 T A 1: 59,702,872 Y187N probably damaging Het
Npc1l1 A G 11: 6,217,785 V1002A probably benign Het
Ntrk1 A T 3: 87,780,077 Y683* probably null Het
Olfr1053 T C 2: 86,314,530 Y252C probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Olfr71 C T 4: 43,705,923 C215Y probably damaging Het
Olfr742 A G 14: 50,516,127 I308V probably benign Het
Osbpl6 T C 2: 76,579,216 V367A probably benign Het
Phip A G 9: 82,900,828 W855R probably damaging Het
Phlpp1 A G 1: 106,380,385 S1131G probably damaging Het
Pkdrej A T 15: 85,817,241 V1498E probably benign Het
Prkaa2 T C 4: 105,051,223 N152D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,002,559 V732M probably damaging Het
Rccd1 C T 7: 80,320,111 W223* probably null Het
Riox2 T A 16: 59,475,583 S16T possibly damaging Het
Scn5a C T 9: 119,521,301 V836I probably damaging Het
Serpinf1 G A 11: 75,410,250 R380C probably damaging Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shprh T A 10: 11,164,744 C134S probably damaging Het
Skint8 T A 4: 111,928,727 C123* probably null Het
Slc16a13 G T 11: 70,218,595 S360* probably null Het
Srr A G 11: 74,908,803 I282T possibly damaging Het
Trpm1 T C 7: 64,223,817 F607L possibly damaging Het
Ttn T C 2: 76,709,526 D34372G probably benign Het
Tub C T 7: 109,029,681 T401I probably damaging Het
Wdhd1 T C 14: 47,256,236 E9G probably damaging Het
Wdyhv1 T A 15: 58,157,889 probably null Het
Yipf3 T A 17: 46,250,861 F198Y possibly damaging Het
Zfp955a C T 17: 33,241,817 R447K probably benign Het
Other mutations in Arrdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Arrdc4 APN 7 68744832 nonsense probably null
IGL02164:Arrdc4 APN 7 68739537 unclassified probably benign
IGL03009:Arrdc4 APN 7 68739493 missense probably damaging 1.00
R0454:Arrdc4 UTSW 7 68741871 missense probably damaging 1.00
R1146:Arrdc4 UTSW 7 68740008 missense probably damaging 0.99
R1146:Arrdc4 UTSW 7 68740008 missense probably damaging 0.99
R1764:Arrdc4 UTSW 7 68741874 missense probably damaging 1.00
R1956:Arrdc4 UTSW 7 68741799 missense probably benign 0.16
R4717:Arrdc4 UTSW 7 68741658 missense probably damaging 0.98
R6321:Arrdc4 UTSW 7 68749045 missense probably benign 0.21
R6784:Arrdc4 UTSW 7 68748846 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTAAGTTGGCACGACTCGTAAC -3'
(R):5'- CAGGCTGGTGCAGATTTTAGCAATG -3'

Sequencing Primer
(F):5'- GAAGGCCAGTCTTCATGTACC -3'
(R):5'- ATGCCTTGAAATTCTTCGGAACC -3'
Posted On2014-04-24