Incidental Mutation 'R1588:Shprh'
ID177648
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene NameSNF2 histone linker PHD RING helicase
Synonyms2610103K11Rik, D230017O13Rik
MMRRC Submission 039625-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R1588 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location11149427-11217595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11164744 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 134 (C134S)
Ref Sequence ENSEMBL: ENSMUSP00000125127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: C654S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: C654S

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054814
AA Change: C654S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: C654S

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: C654S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: C654S

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159553
Predicted Effect probably damaging
Transcript: ENSMUST00000159810
AA Change: C654S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: C654S

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000160461
AA Change: C134S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112
AA Change: C134S

DomainStartEndE-ValueType
PHD 131 178 2.33e-5 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Adamts13 A T 2: 26,975,675 I81F probably benign Het
Akap11 A T 14: 78,510,245 N1567K possibly damaging Het
Arrdc4 G A 7: 68,741,736 T261M possibly damaging Het
C4b T C 17: 34,741,025 I326V probably benign Het
Casp8ap2 G A 4: 32,640,541 A532T probably benign Het
Ccdc129 A G 6: 55,978,503 E1032G possibly damaging Het
Ccdc134 A G 15: 82,135,136 T187A probably benign Het
Cdh8 T C 8: 99,190,407 N359D probably damaging Het
Cep97 A G 16: 55,927,821 L82P probably damaging Het
Cfap53 A T 18: 74,307,373 R404S probably benign Het
Chrng C A 1: 87,207,507 F179L probably damaging Het
Ddi1 A T 9: 6,265,391 I326K probably damaging Het
Decr2 T C 17: 26,083,028 T243A possibly damaging Het
Dip2c T C 13: 9,665,864 V1502A probably damaging Het
Edem1 T C 6: 108,841,679 V216A probably damaging Het
Fat2 A C 11: 55,283,404 V2161G probably damaging Het
Fbn1 T C 2: 125,319,114 T2169A probably benign Het
Fmn1 T C 2: 113,365,698 V581A unknown Het
Gm13088 G T 4: 143,655,551 L192M probably damaging Het
Hip1r A T 5: 123,996,575 D350V probably damaging Het
Ift140 G A 17: 25,087,985 R898H probably damaging Het
Il12a A G 3: 68,695,563 I159V probably benign Het
Kl A G 5: 150,982,632 E489G probably benign Het
Klhl3 T C 13: 58,013,898 E461G probably damaging Het
Masp1 T C 16: 23,494,654 Y177C probably damaging Het
Nop58 T A 1: 59,702,872 Y187N probably damaging Het
Npc1l1 A G 11: 6,217,785 V1002A probably benign Het
Ntrk1 A T 3: 87,780,077 Y683* probably null Het
Olfr1053 T C 2: 86,314,530 Y252C probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Olfr71 C T 4: 43,705,923 C215Y probably damaging Het
Olfr742 A G 14: 50,516,127 I308V probably benign Het
Osbpl6 T C 2: 76,579,216 V367A probably benign Het
Phip A G 9: 82,900,828 W855R probably damaging Het
Phlpp1 A G 1: 106,380,385 S1131G probably damaging Het
Pkdrej A T 15: 85,817,241 V1498E probably benign Het
Prkaa2 T C 4: 105,051,223 N152D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,002,559 V732M probably damaging Het
Rccd1 C T 7: 80,320,111 W223* probably null Het
Riox2 T A 16: 59,475,583 S16T possibly damaging Het
Scn5a C T 9: 119,521,301 V836I probably damaging Het
Serpinf1 G A 11: 75,410,250 R380C probably damaging Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Skint8 T A 4: 111,928,727 C123* probably null Het
Slc16a13 G T 11: 70,218,595 S360* probably null Het
Srr A G 11: 74,908,803 I282T possibly damaging Het
Trpm1 T C 7: 64,223,817 F607L possibly damaging Het
Ttn T C 2: 76,709,526 D34372G probably benign Het
Tub C T 7: 109,029,681 T401I probably damaging Het
Wdhd1 T C 14: 47,256,236 E9G probably damaging Het
Wdyhv1 T A 15: 58,157,889 probably null Het
Yipf3 T A 17: 46,250,861 F198Y possibly damaging Het
Zfp955a C T 17: 33,241,817 R447K probably benign Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 synonymous probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGGAGTCTGTGCAAGTACTG -3'
(R):5'- ACGTGCCGATTGATTTCATCCACC -3'

Sequencing Primer
(F):5'- AGTCTGTGCAAGTACTGATGTTC -3'
(R):5'- CTCGGAGAGATGATCAGAGTTGC -3'
Posted On2014-04-24