Incidental Mutation 'R1588:Npc1l1'
ID177649
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission 039625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R1588 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6217785 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1002 (V1002A)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect probably benign
Transcript: ENSMUST00000004505
AA Change: V1002A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: V1002A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Adamts13 A T 2: 26,975,675 I81F probably benign Het
Akap11 A T 14: 78,510,245 N1567K possibly damaging Het
Arrdc4 G A 7: 68,741,736 T261M possibly damaging Het
C4b T C 17: 34,741,025 I326V probably benign Het
Casp8ap2 G A 4: 32,640,541 A532T probably benign Het
Ccdc129 A G 6: 55,978,503 E1032G possibly damaging Het
Ccdc134 A G 15: 82,135,136 T187A probably benign Het
Cdh8 T C 8: 99,190,407 N359D probably damaging Het
Cep97 A G 16: 55,927,821 L82P probably damaging Het
Cfap53 A T 18: 74,307,373 R404S probably benign Het
Chrng C A 1: 87,207,507 F179L probably damaging Het
Ddi1 A T 9: 6,265,391 I326K probably damaging Het
Decr2 T C 17: 26,083,028 T243A possibly damaging Het
Dip2c T C 13: 9,665,864 V1502A probably damaging Het
Edem1 T C 6: 108,841,679 V216A probably damaging Het
Fat2 A C 11: 55,283,404 V2161G probably damaging Het
Fbn1 T C 2: 125,319,114 T2169A probably benign Het
Fmn1 T C 2: 113,365,698 V581A unknown Het
Gm13088 G T 4: 143,655,551 L192M probably damaging Het
Hip1r A T 5: 123,996,575 D350V probably damaging Het
Ift140 G A 17: 25,087,985 R898H probably damaging Het
Il12a A G 3: 68,695,563 I159V probably benign Het
Kl A G 5: 150,982,632 E489G probably benign Het
Klhl3 T C 13: 58,013,898 E461G probably damaging Het
Masp1 T C 16: 23,494,654 Y177C probably damaging Het
Nop58 T A 1: 59,702,872 Y187N probably damaging Het
Ntrk1 A T 3: 87,780,077 Y683* probably null Het
Olfr1053 T C 2: 86,314,530 Y252C probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Olfr71 C T 4: 43,705,923 C215Y probably damaging Het
Olfr742 A G 14: 50,516,127 I308V probably benign Het
Osbpl6 T C 2: 76,579,216 V367A probably benign Het
Phip A G 9: 82,900,828 W855R probably damaging Het
Phlpp1 A G 1: 106,380,385 S1131G probably damaging Het
Pkdrej A T 15: 85,817,241 V1498E probably benign Het
Prkaa2 T C 4: 105,051,223 N152D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,002,559 V732M probably damaging Het
Rccd1 C T 7: 80,320,111 W223* probably null Het
Riox2 T A 16: 59,475,583 S16T possibly damaging Het
Scn5a C T 9: 119,521,301 V836I probably damaging Het
Serpinf1 G A 11: 75,410,250 R380C probably damaging Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shprh T A 10: 11,164,744 C134S probably damaging Het
Skint8 T A 4: 111,928,727 C123* probably null Het
Slc16a13 G T 11: 70,218,595 S360* probably null Het
Srr A G 11: 74,908,803 I282T possibly damaging Het
Trpm1 T C 7: 64,223,817 F607L possibly damaging Het
Ttn T C 2: 76,709,526 D34372G probably benign Het
Tub C T 7: 109,029,681 T401I probably damaging Het
Wdhd1 T C 14: 47,256,236 E9G probably damaging Het
Wdyhv1 T A 15: 58,157,889 probably null Het
Yipf3 T A 17: 46,250,861 F198Y possibly damaging Het
Zfp955a C T 17: 33,241,817 R447K probably benign Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGAGACCTTGTCCTGTCAGTCC -3'
(R):5'- TCACACTATCAGTGTCCCCTGGAG -3'

Sequencing Primer
(F):5'- TCACTGTGCCCCAGAAAGG -3'
(R):5'- CTATGGCCCTGCATATGGAG -3'
Posted On2014-04-24