Incidental Mutation 'R1588:Srr'
ID177652
Institutional Source Beutler Lab
Gene Symbol Srr
Ensembl Gene ENSMUSG00000001323
Gene Nameserine racemase
Synonyms
MMRRC Submission 039625-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R1588 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74906359-74925948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74908803 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 282 (I282T)
Ref Sequence ENSEMBL: ENSMUSP00000113372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045807] [ENSMUST00000065211] [ENSMUST00000108447] [ENSMUST00000108448] [ENSMUST00000121738] [ENSMUST00000123855] [ENSMUST00000128230] [ENSMUST00000128556] [ENSMUST00000138612] [ENSMUST00000153316] [ENSMUST00000155702]
Predicted Effect probably benign
Transcript: ENSMUST00000045807
SMART Domains Protein: ENSMUSP00000039027
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
AARP2CN 228 309 1.14e-28 SMART
low complexity region 373 383 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
low complexity region 429 452 N/A INTRINSIC
coiled coil region 453 478 N/A INTRINSIC
DUF663 486 772 2.6e-179 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065211
AA Change: I282T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067552
Gene: ENSMUSG00000001323
AA Change: I282T

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104449
Predicted Effect possibly damaging
Transcript: ENSMUST00000108447
AA Change: I257T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104086
Gene: ENSMUSG00000001323
AA Change: I257T

DomainStartEndE-ValueType
Pfam:PALP 19 179 1.8e-41 PFAM
Pfam:PALP 173 289 4.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108448
AA Change: I282T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104087
Gene: ENSMUSG00000001323
AA Change: I282T

DomainStartEndE-ValueType
Pfam:PALP 19 314 2.1e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121738
AA Change: I282T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113372
Gene: ENSMUSG00000001323
AA Change: I282T

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123855
SMART Domains Protein: ENSMUSP00000118485
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 166 1.5e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127499
Predicted Effect probably benign
Transcript: ENSMUST00000128230
SMART Domains Protein: ENSMUSP00000121384
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128556
SMART Domains Protein: ENSMUSP00000120012
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 182 2.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135587
Predicted Effect probably benign
Transcript: ENSMUST00000138612
SMART Domains Protein: ENSMUSP00000119256
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 112 4.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147817
Predicted Effect probably benign
Transcript: ENSMUST00000153316
Predicted Effect probably benign
Transcript: ENSMUST00000155702
SMART Domains Protein: ENSMUSP00000119868
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased D-serine levels in the cerebral cortex and hippocampus, and neuronal damage associated with NMDA excitotoxicity and beta-amyloid peptide 1-42 exposure is decreased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Adamts13 A T 2: 26,975,675 I81F probably benign Het
Akap11 A T 14: 78,510,245 N1567K possibly damaging Het
Arrdc4 G A 7: 68,741,736 T261M possibly damaging Het
C4b T C 17: 34,741,025 I326V probably benign Het
Casp8ap2 G A 4: 32,640,541 A532T probably benign Het
Ccdc129 A G 6: 55,978,503 E1032G possibly damaging Het
Ccdc134 A G 15: 82,135,136 T187A probably benign Het
Cdh8 T C 8: 99,190,407 N359D probably damaging Het
Cep97 A G 16: 55,927,821 L82P probably damaging Het
Cfap53 A T 18: 74,307,373 R404S probably benign Het
Chrng C A 1: 87,207,507 F179L probably damaging Het
Ddi1 A T 9: 6,265,391 I326K probably damaging Het
Decr2 T C 17: 26,083,028 T243A possibly damaging Het
Dip2c T C 13: 9,665,864 V1502A probably damaging Het
Edem1 T C 6: 108,841,679 V216A probably damaging Het
Fat2 A C 11: 55,283,404 V2161G probably damaging Het
Fbn1 T C 2: 125,319,114 T2169A probably benign Het
Fmn1 T C 2: 113,365,698 V581A unknown Het
Gm13088 G T 4: 143,655,551 L192M probably damaging Het
Hip1r A T 5: 123,996,575 D350V probably damaging Het
Ift140 G A 17: 25,087,985 R898H probably damaging Het
Il12a A G 3: 68,695,563 I159V probably benign Het
Kl A G 5: 150,982,632 E489G probably benign Het
Klhl3 T C 13: 58,013,898 E461G probably damaging Het
Masp1 T C 16: 23,494,654 Y177C probably damaging Het
Nop58 T A 1: 59,702,872 Y187N probably damaging Het
Npc1l1 A G 11: 6,217,785 V1002A probably benign Het
Ntrk1 A T 3: 87,780,077 Y683* probably null Het
Olfr1053 T C 2: 86,314,530 Y252C probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Olfr71 C T 4: 43,705,923 C215Y probably damaging Het
Olfr742 A G 14: 50,516,127 I308V probably benign Het
Osbpl6 T C 2: 76,579,216 V367A probably benign Het
Phip A G 9: 82,900,828 W855R probably damaging Het
Phlpp1 A G 1: 106,380,385 S1131G probably damaging Het
Pkdrej A T 15: 85,817,241 V1498E probably benign Het
Prkaa2 T C 4: 105,051,223 N152D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,002,559 V732M probably damaging Het
Rccd1 C T 7: 80,320,111 W223* probably null Het
Riox2 T A 16: 59,475,583 S16T possibly damaging Het
Scn5a C T 9: 119,521,301 V836I probably damaging Het
Serpinf1 G A 11: 75,410,250 R380C probably damaging Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shprh T A 10: 11,164,744 C134S probably damaging Het
Skint8 T A 4: 111,928,727 C123* probably null Het
Slc16a13 G T 11: 70,218,595 S360* probably null Het
Trpm1 T C 7: 64,223,817 F607L possibly damaging Het
Ttn T C 2: 76,709,526 D34372G probably benign Het
Tub C T 7: 109,029,681 T401I probably damaging Het
Wdhd1 T C 14: 47,256,236 E9G probably damaging Het
Wdyhv1 T A 15: 58,157,889 probably null Het
Yipf3 T A 17: 46,250,861 F198Y possibly damaging Het
Zfp955a C T 17: 33,241,817 R447K probably benign Het
Other mutations in Srr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02949:Srr APN 11 74908737 missense probably benign 0.00
IGL03268:Srr APN 11 74913117 missense probably benign 0.06
R0718:Srr UTSW 11 74911065 missense possibly damaging 0.74
R1960:Srr UTSW 11 74908716 missense probably damaging 1.00
R1986:Srr UTSW 11 74908719 missense probably damaging 1.00
R4043:Srr UTSW 11 74909121 missense probably benign 0.08
R4112:Srr UTSW 11 74913072 missense probably benign
R4877:Srr UTSW 11 74907780 unclassified probably benign
R5856:Srr UTSW 11 74913012 missense possibly damaging 0.92
R5959:Srr UTSW 11 74911065 missense possibly damaging 0.74
R6362:Srr UTSW 11 74910202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAACCGTCTGGTAAGGAGCTG -3'
(R):5'- TATACGCTGCTGAGCCCTCGAATG -3'

Sequencing Primer
(F):5'- CCCACTGAGTACAATGCAGA -3'
(R):5'- TCGAATGCAGATGACTGCTAC -3'
Posted On2014-04-24