Incidental Mutation 'R1588:Klhl3'
ID177659
Institutional Source Beutler Lab
Gene Symbol Klhl3
Ensembl Gene ENSMUSG00000014164
Gene Namekelch-like 3
SynonymsEG627648, 7530408C15Rik
MMRRC Submission 039625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1588 (G1)
Quality Score211
Status Not validated
Chromosome13
Chromosomal Location58000228-58113592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58013898 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 461 (E461G)
Ref Sequence ENSEMBL: ENSMUSP00000123701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091583] [ENSMUST00000160860]
Predicted Effect probably damaging
Transcript: ENSMUST00000091583
AA Change: E514G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089173
Gene: ENSMUSG00000014164
AA Change: E514G

DomainStartEndE-ValueType
BTB 103 200 9.36e-30 SMART
BACK 205 307 7.49e-42 SMART
Kelch 355 400 3.31e-9 SMART
Kelch 401 447 3.82e-14 SMART
Kelch 448 494 1.49e-16 SMART
Kelch 495 543 8.58e-17 SMART
Kelch 544 590 4.93e-17 SMART
Kelch 591 638 4.16e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160860
AA Change: E461G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123701
Gene: ENSMUSG00000014164
AA Change: E461G

DomainStartEndE-ValueType
BTB 64 161 9.36e-30 SMART
BACK 166 268 7.49e-42 SMART
Kelch 316 361 3.31e-9 SMART
Kelch 362 408 3.82e-14 SMART
Kelch 409 455 1.49e-16 SMART
Kelch 456 504 8.58e-17 SMART
Kelch 505 551 4.93e-17 SMART
Kelch 552 599 4.16e-15 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and encodes a full-length protein which has an N-terminal BTB domain followed by a BACK domain and six kelch-like repeats in the C-terminus. These kelch-like repeats promote substrate ubiquitination of bound proteins via interaction of the BTB domain with the CUL3 (cullin 3) component of a cullin-RING E3 ubiquitin ligase (CRL) complex. Muatations in this gene cause pseudohypoaldosteronism type IID (PHA2D); a rare Mendelian syndrome featuring hypertension, hyperkalaemia and metabolic acidosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a point mutation display salt-sensitive hypertension, hyperkalemia and metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Adamts13 A T 2: 26,975,675 I81F probably benign Het
Akap11 A T 14: 78,510,245 N1567K possibly damaging Het
Arrdc4 G A 7: 68,741,736 T261M possibly damaging Het
C4b T C 17: 34,741,025 I326V probably benign Het
Casp8ap2 G A 4: 32,640,541 A532T probably benign Het
Ccdc129 A G 6: 55,978,503 E1032G possibly damaging Het
Ccdc134 A G 15: 82,135,136 T187A probably benign Het
Cdh8 T C 8: 99,190,407 N359D probably damaging Het
Cep97 A G 16: 55,927,821 L82P probably damaging Het
Cfap53 A T 18: 74,307,373 R404S probably benign Het
Chrng C A 1: 87,207,507 F179L probably damaging Het
Ddi1 A T 9: 6,265,391 I326K probably damaging Het
Decr2 T C 17: 26,083,028 T243A possibly damaging Het
Dip2c T C 13: 9,665,864 V1502A probably damaging Het
Edem1 T C 6: 108,841,679 V216A probably damaging Het
Fat2 A C 11: 55,283,404 V2161G probably damaging Het
Fbn1 T C 2: 125,319,114 T2169A probably benign Het
Fmn1 T C 2: 113,365,698 V581A unknown Het
Gm13088 G T 4: 143,655,551 L192M probably damaging Het
Hip1r A T 5: 123,996,575 D350V probably damaging Het
Ift140 G A 17: 25,087,985 R898H probably damaging Het
Il12a A G 3: 68,695,563 I159V probably benign Het
Kl A G 5: 150,982,632 E489G probably benign Het
Masp1 T C 16: 23,494,654 Y177C probably damaging Het
Nop58 T A 1: 59,702,872 Y187N probably damaging Het
Npc1l1 A G 11: 6,217,785 V1002A probably benign Het
Ntrk1 A T 3: 87,780,077 Y683* probably null Het
Olfr1053 T C 2: 86,314,530 Y252C probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Olfr71 C T 4: 43,705,923 C215Y probably damaging Het
Olfr742 A G 14: 50,516,127 I308V probably benign Het
Osbpl6 T C 2: 76,579,216 V367A probably benign Het
Phip A G 9: 82,900,828 W855R probably damaging Het
Phlpp1 A G 1: 106,380,385 S1131G probably damaging Het
Pkdrej A T 15: 85,817,241 V1498E probably benign Het
Prkaa2 T C 4: 105,051,223 N152D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,002,559 V732M probably damaging Het
Rccd1 C T 7: 80,320,111 W223* probably null Het
Riox2 T A 16: 59,475,583 S16T possibly damaging Het
Scn5a C T 9: 119,521,301 V836I probably damaging Het
Serpinf1 G A 11: 75,410,250 R380C probably damaging Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shprh T A 10: 11,164,744 C134S probably damaging Het
Skint8 T A 4: 111,928,727 C123* probably null Het
Slc16a13 G T 11: 70,218,595 S360* probably null Het
Srr A G 11: 74,908,803 I282T possibly damaging Het
Trpm1 T C 7: 64,223,817 F607L possibly damaging Het
Ttn T C 2: 76,709,526 D34372G probably benign Het
Tub C T 7: 109,029,681 T401I probably damaging Het
Wdhd1 T C 14: 47,256,236 E9G probably damaging Het
Wdyhv1 T A 15: 58,157,889 probably null Het
Yipf3 T A 17: 46,250,861 F198Y possibly damaging Het
Zfp955a C T 17: 33,241,817 R447K probably benign Het
Other mutations in Klhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Klhl3 APN 13 58009422 critical splice acceptor site probably null
IGL01984:Klhl3 APN 13 58011243 splice site probably benign
IGL02022:Klhl3 APN 13 58051064 missense possibly damaging 0.95
IGL02543:Klhl3 APN 13 58018871 missense probably damaging 1.00
R0975:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R1386:Klhl3 UTSW 13 58030433 missense probably damaging 0.99
R1791:Klhl3 UTSW 13 58033230 missense possibly damaging 0.87
R1894:Klhl3 UTSW 13 58009375 missense probably damaging 1.00
R1953:Klhl3 UTSW 13 58011208 missense probably damaging 1.00
R2116:Klhl3 UTSW 13 58018991 missense probably damaging 0.99
R3114:Klhl3 UTSW 13 58051027 critical splice donor site probably null
R4082:Klhl3 UTSW 13 58018797 missense probably null 1.00
R4717:Klhl3 UTSW 13 58030516 missense probably damaging 1.00
R4857:Klhl3 UTSW 13 58018806 missense probably damaging 1.00
R4934:Klhl3 UTSW 13 58102417 nonsense probably null
R5112:Klhl3 UTSW 13 58018889 missense probably damaging 1.00
R5114:Klhl3 UTSW 13 58018967 missense probably benign 0.24
R5547:Klhl3 UTSW 13 58102429 unclassified probably null
R5776:Klhl3 UTSW 13 58005184 missense probably benign 0.00
R6236:Klhl3 UTSW 13 58085062 missense probably damaging 1.00
R6268:Klhl3 UTSW 13 58013842 missense probably damaging 1.00
R6457:Klhl3 UTSW 13 58100378 missense probably benign 0.01
R6559:Klhl3 UTSW 13 58016476 missense probably damaging 1.00
R6580:Klhl3 UTSW 13 58018887 missense possibly damaging 0.75
R6601:Klhl3 UTSW 13 58095116 missense probably damaging 0.96
R6669:Klhl3 UTSW 13 58011152 missense probably benign 0.00
R6904:Klhl3 UTSW 13 58030445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGCACGGTTCAGTGGTTG -3'
(R):5'- AAGCATCTCAGGGCTTCAGAGCAG -3'

Sequencing Primer
(F):5'- GGTCTTTAGTCTCAGCCTGTAAC -3'
(R):5'- AGAGCAAGCTGGGTCCTTC -3'
Posted On2014-04-24