Incidental Mutation 'R1588:Cfap53'
ID177677
Institutional Source Beutler Lab
Gene Symbol Cfap53
Ensembl Gene ENSMUSG00000035394
Gene Namecilia and flagella associated protein 53
Synonyms4933415I03Rik, Ccdc11
MMRRC Submission 039625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1588 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location74283090-74359986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74307373 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 404 (R404S)
Ref Sequence ENSEMBL: ENSMUSP00000110545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114895] [ENSMUST00000176435]
Predicted Effect probably benign
Transcript: ENSMUST00000114895
AA Change: R404S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110545
Gene: ENSMUSG00000035394
AA Change: R404S

DomainStartEndE-ValueType
low complexity region 131 145 N/A INTRINSIC
Pfam:TPH 160 495 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122178
Predicted Effect probably benign
Transcript: ENSMUST00000176435
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. Mutations in this gene are associated with visceral heterotaxy-6, which implicates this gene in determination of left-right asymmetric patterning. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Adamts13 A T 2: 26,975,675 I81F probably benign Het
Akap11 A T 14: 78,510,245 N1567K possibly damaging Het
Arrdc4 G A 7: 68,741,736 T261M possibly damaging Het
C4b T C 17: 34,741,025 I326V probably benign Het
Casp8ap2 G A 4: 32,640,541 A532T probably benign Het
Ccdc129 A G 6: 55,978,503 E1032G possibly damaging Het
Ccdc134 A G 15: 82,135,136 T187A probably benign Het
Cdh8 T C 8: 99,190,407 N359D probably damaging Het
Cep97 A G 16: 55,927,821 L82P probably damaging Het
Chrng C A 1: 87,207,507 F179L probably damaging Het
Ddi1 A T 9: 6,265,391 I326K probably damaging Het
Decr2 T C 17: 26,083,028 T243A possibly damaging Het
Dip2c T C 13: 9,665,864 V1502A probably damaging Het
Edem1 T C 6: 108,841,679 V216A probably damaging Het
Fat2 A C 11: 55,283,404 V2161G probably damaging Het
Fbn1 T C 2: 125,319,114 T2169A probably benign Het
Fmn1 T C 2: 113,365,698 V581A unknown Het
Gm13088 G T 4: 143,655,551 L192M probably damaging Het
Hip1r A T 5: 123,996,575 D350V probably damaging Het
Ift140 G A 17: 25,087,985 R898H probably damaging Het
Il12a A G 3: 68,695,563 I159V probably benign Het
Kl A G 5: 150,982,632 E489G probably benign Het
Klhl3 T C 13: 58,013,898 E461G probably damaging Het
Masp1 T C 16: 23,494,654 Y177C probably damaging Het
Nop58 T A 1: 59,702,872 Y187N probably damaging Het
Npc1l1 A G 11: 6,217,785 V1002A probably benign Het
Ntrk1 A T 3: 87,780,077 Y683* probably null Het
Olfr1053 T C 2: 86,314,530 Y252C probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Olfr71 C T 4: 43,705,923 C215Y probably damaging Het
Olfr742 A G 14: 50,516,127 I308V probably benign Het
Osbpl6 T C 2: 76,579,216 V367A probably benign Het
Phip A G 9: 82,900,828 W855R probably damaging Het
Phlpp1 A G 1: 106,380,385 S1131G probably damaging Het
Pkdrej A T 15: 85,817,241 V1498E probably benign Het
Prkaa2 T C 4: 105,051,223 N152D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,002,559 V732M probably damaging Het
Rccd1 C T 7: 80,320,111 W223* probably null Het
Riox2 T A 16: 59,475,583 S16T possibly damaging Het
Scn5a C T 9: 119,521,301 V836I probably damaging Het
Serpinf1 G A 11: 75,410,250 R380C probably damaging Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shprh T A 10: 11,164,744 C134S probably damaging Het
Skint8 T A 4: 111,928,727 C123* probably null Het
Slc16a13 G T 11: 70,218,595 S360* probably null Het
Srr A G 11: 74,908,803 I282T possibly damaging Het
Trpm1 T C 7: 64,223,817 F607L possibly damaging Het
Ttn T C 2: 76,709,526 D34372G probably benign Het
Tub C T 7: 109,029,681 T401I probably damaging Het
Wdhd1 T C 14: 47,256,236 E9G probably damaging Het
Wdyhv1 T A 15: 58,157,889 probably null Het
Yipf3 T A 17: 46,250,861 F198Y possibly damaging Het
Zfp955a C T 17: 33,241,817 R447K probably benign Het
Other mutations in Cfap53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cfap53 APN 18 74305540 nonsense probably null
IGL00667:Cfap53 APN 18 74300192 missense probably damaging 1.00
IGL00917:Cfap53 APN 18 74299296 missense probably benign 0.08
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0048:Cfap53 UTSW 18 74299173 missense probably benign 0.09
R0601:Cfap53 UTSW 18 74300150 missense possibly damaging 0.94
R0939:Cfap53 UTSW 18 74305730 missense probably null 0.72
R1166:Cfap53 UTSW 18 74300180 missense possibly damaging 0.68
R2105:Cfap53 UTSW 18 74283223 missense possibly damaging 0.73
R2186:Cfap53 UTSW 18 74329505 splice site probably null
R3723:Cfap53 UTSW 18 74359569 missense probably benign 0.13
R3724:Cfap53 UTSW 18 74359569 missense probably benign 0.13
R3904:Cfap53 UTSW 18 74307374 missense probably damaging 0.99
R5156:Cfap53 UTSW 18 74359767 utr 3 prime probably benign
R5262:Cfap53 UTSW 18 74329459 missense probably benign 0.39
R5928:Cfap53 UTSW 18 74359740 missense possibly damaging 0.90
R6405:Cfap53 UTSW 18 74359606 missense probably damaging 1.00
R6653:Cfap53 UTSW 18 74300209 missense probably damaging 0.97
R6675:Cfap53 UTSW 18 74307376 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACTATCTAATGCAGCGACGAGAGG -3'
(R):5'- ACGGTACTCAAAGCACACACTGTTC -3'

Sequencing Primer
(F):5'- ACGAGAGGAAGAAAAAGCCC -3'
(R):5'- GCAGGAGTCTTAGTACTTGCAAC -3'
Posted On2014-04-24