Mutagenetix > Incidental Mutations

Incidental Mutation 'R1588:Cfap53'

177677

Institutional Source

Beutler Lab

Gene Symbol

Cfap53

Ensembl Gene

ENSMUSG00000035394

Gene Name

cilia and flagella associated protein 53

Synonyms

4933415I03Rik, Ccdc11

MMRRC Submission

039625-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R1588 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74283090-74359986 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 74307373 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 404 (R404S)

Ref Sequence

ENSEMBL: ENSMUSP00000110545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114895] [ENSMUST00000176435]

Predicted Effect

probably benign
Transcript: ENSMUST00000114895
AA Change: R404S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110545
Gene: ENSMUSG00000035394
AA Change: R404S

Domain	Start	End	E-Value	Type
low complexity region	131	145	N/A	INTRINSIC
Pfam:TPH	160	495	1.3e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122178

Predicted Effect

probably benign
Transcript: ENSMUST00000176435

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. Mutations in this gene are associated with visceral heterotaxy-6, which implicates this gene in determination of left-right asymmetric patterning. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	G	14: 118,534,072	V869A	probably benign	Het
Ablim1	C	T	19: 57,083,547	M1I	probably null	Het
Adamts13	A	T	2: 26,975,675	I81F	probably benign	Het
Akap11	A	T	14: 78,510,245	N1567K	possibly damaging	Het
Arrdc4	G	A	7: 68,741,736	T261M	possibly damaging	Het
C4b	T	C	17: 34,741,025	I326V	probably benign	Het
Casp8ap2	G	A	4: 32,640,541	A532T	probably benign	Het
Ccdc129	A	G	6: 55,978,503	E1032G	possibly damaging	Het
Ccdc134	A	G	15: 82,135,136	T187A	probably benign	Het
Cdh8	T	C	8: 99,190,407	N359D	probably damaging	Het
Cep97	A	G	16: 55,927,821	L82P	probably damaging	Het
Chrng	C	A	1: 87,207,507	F179L	probably damaging	Het
Ddi1	A	T	9: 6,265,391	I326K	probably damaging	Het
Decr2	T	C	17: 26,083,028	T243A	possibly damaging	Het
Dip2c	T	C	13: 9,665,864	V1502A	probably damaging	Het
Edem1	T	C	6: 108,841,679	V216A	probably damaging	Het
Fat2	A	C	11: 55,283,404	V2161G	probably damaging	Het
Fbn1	T	C	2: 125,319,114	T2169A	probably benign	Het
Fmn1	T	C	2: 113,365,698	V581A	unknown	Het
Gm13088	G	T	4: 143,655,551	L192M	probably damaging	Het
Hip1r	A	T	5: 123,996,575	D350V	probably damaging	Het
Ift140	G	A	17: 25,087,985	R898H	probably damaging	Het
Il12a	A	G	3: 68,695,563	I159V	probably benign	Het
Kl	A	G	5: 150,982,632	E489G	probably benign	Het
Klhl3	T	C	13: 58,013,898	E461G	probably damaging	Het
Masp1	T	C	16: 23,494,654	Y177C	probably damaging	Het
Nop58	T	A	1: 59,702,872	Y187N	probably damaging	Het
Npc1l1	A	G	11: 6,217,785	V1002A	probably benign	Het
Ntrk1	A	T	3: 87,780,077	Y683*	probably null	Het
Olfr1053	T	C	2: 86,314,530	Y252C	probably damaging	Het
Olfr1362	C	T	13: 21,611,913	D19N	probably benign	Het
Olfr71	C	T	4: 43,705,923	C215Y	probably damaging	Het
Olfr742	A	G	14: 50,516,127	I308V	probably benign	Het
Osbpl6	T	C	2: 76,579,216	V367A	probably benign	Het
Phip	A	G	9: 82,900,828	W855R	probably damaging	Het
Phlpp1	A	G	1: 106,380,385	S1131G	probably damaging	Het
Pkdrej	A	T	15: 85,817,241	V1498E	probably benign	Het
Prkaa2	T	C	4: 105,051,223	N152D	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Pxdn	G	A	12: 30,002,559	V732M	probably damaging	Het
Rccd1	C	T	7: 80,320,111	W223*	probably null	Het
Riox2	T	A	16: 59,475,583	S16T	possibly damaging	Het
Scn5a	C	T	9: 119,521,301	V836I	probably damaging	Het
Serpinf1	G	A	11: 75,410,250	R380C	probably damaging	Het
Sf3b1	A	T	1: 54,997,177	N912K	probably benign	Het
Shprh	T	A	10: 11,164,744	C134S	probably damaging	Het
Skint8	T	A	4: 111,928,727	C123*	probably null	Het
Slc16a13	G	T	11: 70,218,595	S360*	probably null	Het
Srr	A	G	11: 74,908,803	I282T	possibly damaging	Het
Trpm1	T	C	7: 64,223,817	F607L	possibly damaging	Het
Ttn	T	C	2: 76,709,526	D34372G	probably benign	Het
Tub	C	T	7: 109,029,681	T401I	probably damaging	Het
Wdhd1	T	C	14: 47,256,236	E9G	probably damaging	Het
Wdyhv1	T	A	15: 58,157,889		probably null	Het
Yipf3	T	A	17: 46,250,861	F198Y	possibly damaging	Het
Zfp955a	C	T	17: 33,241,817	R447K	probably benign	Het

Other mutations in Cfap53

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00579:Cfap53	APN	18	74305540	nonsense	probably null
IGL00667:Cfap53	APN	18	74300192	missense	probably damaging	1.00
IGL00917:Cfap53	APN	18	74299296	missense	probably benign	0.08
R0009:Cfap53	UTSW	18	74299176	missense	probably benign	0.00
R0009:Cfap53	UTSW	18	74299176	missense	probably benign	0.00
R0035:Cfap53	UTSW	18	74300207	missense	probably damaging	1.00
R0035:Cfap53	UTSW	18	74300207	missense	probably damaging	1.00
R0048:Cfap53	UTSW	18	74299173	missense	probably benign	0.09
R0601:Cfap53	UTSW	18	74300150	missense	possibly damaging	0.94
R0939:Cfap53	UTSW	18	74305730	missense	probably null	0.72
R1166:Cfap53	UTSW	18	74300180	missense	possibly damaging	0.68
R2105:Cfap53	UTSW	18	74283223	missense	possibly damaging	0.73
R2186:Cfap53	UTSW	18	74329505	splice site	probably null
R3723:Cfap53	UTSW	18	74359569	missense	probably benign	0.13
R3724:Cfap53	UTSW	18	74359569	missense	probably benign	0.13
R3904:Cfap53	UTSW	18	74307374	missense	probably damaging	0.99
R5156:Cfap53	UTSW	18	74359767	utr 3 prime	probably benign
R5262:Cfap53	UTSW	18	74329459	missense	probably benign	0.39
R5928:Cfap53	UTSW	18	74359740	missense	possibly damaging	0.90
R6405:Cfap53	UTSW	18	74359606	missense	probably damaging	1.00
R6653:Cfap53	UTSW	18	74300209	missense	probably damaging	0.97
R6675:Cfap53	UTSW	18	74307376	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGACTATCTAATGCAGCGACGAGAGG -3'
(R):5'- ACGGTACTCAAAGCACACACTGTTC -3'

Sequencing Primer
(F):5'- ACGAGAGGAAGAAAAAGCCC -3'
(R):5'- GCAGGAGTCTTAGTACTTGCAAC -3'

Posted On

2014-04-24