Incidental Mutation 'R0117:Btaf1'
ID177860
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene NameB-TFIID TATA-box binding protein associated factor 1
SynonymsE430027O22Rik
MMRRC Submission 038403-MU
Accession Numbers

Genbank: NM_001080706

Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R0117 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location36926079-37012752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36969968 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 486 (T486A)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: T486A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: T486A

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36989002 missense probably benign
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1649:Btaf1 UTSW 19 36981722 missense probably benign
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3623:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4796:Btaf1 UTSW 19 36956428 missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4925:Btaf1 UTSW 19 37011333 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36988173 critical splice donor site probably null
R5654:Btaf1 UTSW 19 36983615 missense probably benign 0.35
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
R7034:Btaf1 UTSW 19 37004469 missense probably benign
R7036:Btaf1 UTSW 19 37004469 missense probably benign
R7085:Btaf1 UTSW 19 36972918 missense probably benign
R7097:Btaf1 UTSW 19 36949102 missense probably damaging 1.00
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTATTGACTCGTAGTGACCCTTGG -3'
(R):5'- CATGTTAGGCGGACAATCTCCCAC -3'

Sequencing Primer
(F):5'- CGTAGTGACCCTTGGAATCTAATTTG -3'
(R):5'- tcgtaaccactcagccatc -3'
Posted On2014-04-30