Incidental Mutation 'R0018:Pdzd8'
ID177888
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission 038313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0018 (G1)
Quality Score70
Status Validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59300673 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 765 (R765H)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084] [ENSMUST00000099274]
Predicted Effect probably benign
Transcript: ENSMUST00000026084
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: R765H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: R765H

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,154,605 D264V probably benign Het
Abca17 T C 17: 24,313,188 probably null Het
Afp A C 5: 90,506,741 Q546P probably damaging Het
Api5 A T 2: 94,420,984 probably null Het
Atp2b4 T A 1: 133,717,871 I982F probably damaging Het
BC024139 G A 15: 76,120,887 Q592* probably null Het
Capn7 T A 14: 31,354,112 C290* probably null Het
Celsr1 T A 15: 86,031,042 D910V possibly damaging Het
Chga T C 12: 102,558,505 S45P probably damaging Het
Cpne2 T A 8: 94,556,053 C59S possibly damaging Het
Cyp2b13 G A 7: 26,085,950 R248H probably benign Het
Cyr61 A G 3: 145,649,431 L23P probably damaging Het
Dennd1a T A 2: 37,858,460 T336S possibly damaging Het
Drc7 A G 8: 95,074,234 Y628C probably damaging Het
Dse A G 10: 34,153,468 V542A probably benign Het
Dspp A T 5: 104,178,230 S820C unknown Het
Eif5b T C 1: 38,018,889 S91P unknown Het
Epop A G 11: 97,628,191 V364A probably benign Het
Ext2 G A 2: 93,795,692 P341L probably damaging Het
Galns T C 8: 122,584,985 T429A probably benign Het
Gm11639 G A 11: 104,721,552 probably null Het
Gsx2 A G 5: 75,077,167 K260R probably damaging Het
H2-M10.6 A C 17: 36,814,049 H286P probably damaging Het
Hectd4 A G 5: 121,254,179 N169D possibly damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hmcn1 T C 1: 150,652,551 D3282G probably benign Het
Hnmt T A 2: 24,003,628 N285Y possibly damaging Het
Hr A G 14: 70,558,277 R450G probably benign Het
Kat6a A G 8: 22,929,273 D684G possibly damaging Het
Kif27 T G 13: 58,288,053 I1309L probably benign Het
Man2b1 T A 8: 85,097,489 V1005E probably damaging Het
Me2 A T 18: 73,791,852 F265I possibly damaging Het
Myo9a A T 9: 59,871,724 T1588S probably benign Het
Neu4 T A 1: 94,025,338 D476E probably benign Het
Nlrp9c T A 7: 26,371,998 Q895L possibly damaging Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr406 A C 11: 74,270,108 T240P probably benign Het
Plk1 T C 7: 122,168,985 probably null Het
Ppfia2 A G 10: 106,842,786 probably benign Het
Prkdc T C 16: 15,726,542 Y1799H probably benign Het
Psmc1 T C 12: 100,116,692 probably benign Het
Ptchd3 A C 11: 121,842,344 I687L probably benign Het
Ptprh A G 7: 4,601,846 probably null Het
Pus3 A G 9: 35,566,624 D384G probably benign Het
Rab44 C T 17: 29,139,380 P181S probably benign Het
Rasa2 A G 9: 96,571,963 S307P probably damaging Het
Rbpms2 A G 9: 65,651,078 D142G probably damaging Het
Reln A T 5: 21,925,371 D2647E probably benign Het
Ryr2 G A 13: 11,595,223 T4239I possibly damaging Het
Sctr C A 1: 120,043,556 probably benign Het
Serpinb6e A T 13: 33,837,845 Y167N probably damaging Het
Slc13a5 T C 11: 72,266,475 I31V probably benign Het
Slc15a4 A T 5: 127,602,010 I422N probably damaging Het
Stk24 G A 14: 121,308,007 probably benign Het
Vmn1r213 T A 13: 23,012,141 V298D probably damaging Het
Xdh C T 17: 73,925,025 R230H probably benign Het
Zfp418 A T 7: 7,182,450 S471C probably benign Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
stronghold UTSW 19 59345352 nonsense probably null
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGGAAGCAGCTTTTGTCCAAAC -3'
(R):5'- TCAAGAACCAGAGCGTCCTGTGTG -3'

Sequencing Primer
(F):5'- ATCACACCAAGTTGGGTTCTG -3'
(R):5'- GTTTGACATAGAAGCCTGCC -3'
Posted On2014-04-30