Incidental Mutation 'R0025:Hc'
ID177889
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
MMRRC Submission 038320-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.773) question?
Stock #R0025 (G1)
Quality Score43
Status Validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34986292 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1581 (Y1581H)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure
Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028233
AA Change: Y1581H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: Y1581H

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156049
Predicted Effect unknown
Transcript: ENSMUST00000156412
AA Change: Y101H
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency 98% (115/117)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 76,000,115 probably benign Het
Acsm1 A T 7: 119,658,315 T435S probably damaging Het
Agtpbp1 G A 13: 59,500,200 T602I probably benign Het
Ahnak2 T A 12: 112,785,534 D231V probably damaging Het
Ampd3 G A 7: 110,793,669 D215N probably benign Het
Ankrd17 T C 5: 90,250,405 D1762G probably damaging Het
Asb8 C T 15: 98,142,671 V37I possibly damaging Het
Bicra T C 7: 15,987,511 T694A possibly damaging Het
Btnl6 A T 17: 34,514,299 M234K probably benign Het
Ccnb1 A T 13: 100,779,781 V336D probably damaging Het
Cdca8 A T 4: 124,921,254 L190Q possibly damaging Het
Cep290 A T 10: 100,537,831 L1324F probably damaging Het
Ces1f T C 8: 93,271,885 E161G probably benign Het
Ces2g A G 8: 104,965,996 probably benign Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Clec3b A G 9: 123,157,025 T163A probably benign Het
Cntnap4 T G 8: 112,803,164 L668R probably damaging Het
Col27a1 A G 4: 63,275,977 D857G probably damaging Het
Csf1 A G 3: 107,748,644 V245A probably benign Het
Ctss A G 3: 95,550,137 Y302C probably damaging Het
Cyb5d1 A G 11: 69,394,966 probably null Het
Cyp1a2 A G 9: 57,682,061 S157P probably damaging Het
Cyp2b9 A T 7: 26,200,813 T349S probably benign Het
Dennd6b T C 15: 89,186,183 I428V probably benign Het
Denr A G 5: 123,927,235 probably benign Het
Dnah9 G A 11: 65,969,955 probably benign Het
Dock3 G T 9: 106,913,268 Q1419K possibly damaging Het
Dph3b-ps A T 13: 106,546,867 noncoding transcript Het
Emc7 G T 2: 112,459,485 D87Y probably damaging Het
Enah T C 1: 181,913,373 E462G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Enpp6 A G 8: 47,066,000 K268E probably damaging Het
Eps15l1 T G 8: 72,381,497 probably benign Het
Fam151a T C 4: 106,748,174 Y578H probably benign Het
Fmn2 T C 1: 174,791,314 V1512A probably damaging Het
Focad C A 4: 88,408,959 N168K probably benign Het
Fyco1 A G 9: 123,829,009 C701R probably damaging Het
Gabbr1 G T 17: 37,067,210 probably benign Het
Golga7b A T 19: 42,266,839 E76V probably damaging Het
Gucy2d A G 7: 98,467,752 D924G probably benign Het
H2-M9 A G 17: 36,641,755 F133S probably damaging Het
Herc3 C T 6: 58,874,308 P514L probably damaging Het
Hormad1 T C 3: 95,585,125 probably benign Het
Iigp1 T A 18: 60,390,787 S326T possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kcnk7 T G 19: 5,707,014 *344G probably null Het
Kif13a A G 13: 46,786,511 probably null Het
Kif1a A C 1: 93,042,358 I1027S probably damaging Het
Kif2c G T 4: 117,165,517 H416Q probably damaging Het
Map3k1 A G 13: 111,756,129 V864A probably benign Het
Mark2 T C 19: 7,285,922 D160G probably damaging Het
Mbd4 A G 6: 115,844,568 probably null Het
Micu1 A G 10: 59,788,877 probably null Het
Mink1 T C 11: 70,613,042 W1263R probably damaging Het
Mov10 A C 3: 104,804,603 L224R probably damaging Het
Ndel1 T C 11: 68,836,173 E226G probably damaging Het
Neb A T 2: 52,222,774 V4336E probably damaging Het
Nln T A 13: 104,036,891 K602N probably damaging Het
Nlrp14 A T 7: 107,181,258 probably benign Het
Nmd3 A T 3: 69,748,321 D445V probably damaging Het
Nop14 T C 5: 34,643,953 I625V probably benign Het
Notch1 T C 2: 26,470,931 Q1134R probably damaging Het
Nr4a2 T C 2: 57,108,615 I392M probably benign Het
Olfr1310 T A 2: 112,009,020 L55F probably damaging Het
Olfr702 A G 7: 106,823,756 F257L possibly damaging Het
Olfr983 A G 9: 40,092,253 S234P probably damaging Het
Osbp T C 19: 11,983,958 Y454H probably damaging Het
Pak4 G A 7: 28,564,283 R343C probably damaging Het
Pak7 T C 2: 136,100,784 K479E possibly damaging Het
Pard3 C A 8: 127,161,308 D73E probably damaging Het
Pcdh10 T C 3: 45,380,499 V416A possibly damaging Het
Plek A C 11: 16,985,594 W261G probably damaging Het
Pmp22 A T 11: 63,158,250 probably null Het
Prph2 A C 17: 46,919,771 K197Q probably benign Het
Prss45 T A 9: 110,840,894 L257Q probably damaging Het
Psmb6 C A 11: 70,526,345 H73Q probably benign Het
Rin2 T C 2: 145,878,832 probably benign Het
Rps6kb1 A T 11: 86,511,587 probably null Het
Scn10a C A 9: 119,670,484 D248Y probably damaging Het
Scn4a C T 11: 106,324,560 V1197I probably benign Het
Siglecf A T 7: 43,351,925 I106F probably benign Het
Sik1 A G 17: 31,847,275 probably benign Het
Slc22a21 T G 11: 53,979,688 N57T probably damaging Het
Slc36a2 A G 11: 55,162,795 L339P probably damaging Het
Slc4a9 G T 18: 36,531,666 probably benign Het
Smg1 G A 7: 118,212,443 T104I possibly damaging Het
Stc2 A T 11: 31,365,559 probably null Het
Stx18 T A 5: 38,092,564 Y74N probably damaging Het
Stxbp5 A T 10: 9,762,748 H1102Q probably damaging Het
Tnfaip8l2 G A 3: 95,140,028 L175F probably damaging Het
Tom1l2 T C 11: 60,230,134 K450E probably damaging Het
Tpo T C 12: 30,100,390 Q497R probably benign Het
Tprgl G T 4: 154,160,345 probably benign Het
Triml2 A G 8: 43,185,432 M146V probably benign Het
Tsc2 A G 17: 24,631,004 probably benign Het
Vit G A 17: 78,599,835 G229R probably benign Het
Vmn2r19 C T 6: 123,331,547 L528F probably benign Het
Vwf T A 6: 125,682,812 I2658N probably benign Het
Wdfy3 T C 5: 101,845,046 D3341G probably damaging Het
Wdr36 T A 18: 32,859,307 D632E probably damaging Het
Wdr47 G T 3: 108,637,991 A733S probably damaging Het
Zcchc6 A T 13: 59,805,328 D99E probably benign Het
Zfp458 T A 13: 67,257,898 H156L probably damaging Het
Zfp654 A G 16: 64,784,818 V466A probably benign Het
Zfp804b T C 5: 6,771,665 E466G probably damaging Het
Zfp941 T C 7: 140,813,272 D58G probably benign Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 intron probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense not run
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTCTGCGATAAGAGCATTTCACGG -3'
(R):5'- CTCAAGGCCATGAGGCACATAAGG -3'

Sequencing Primer
(F):5'- GCATTTCACGGGAATTAGAAGC -3'
(R):5'- AAGTGACCCTGGTCCTGATG -3'
Posted On2014-04-30